\
| Variant ID: vg0432237820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32237820 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
CTAAAAATGGCATAAATCTGAACAGCCCCTAAAGTACATTCAGACTCGGACATACACTCTCCATCCTAAAATAAGTTCAATTTTATATATGAATCTAGAA[G/A,T]
AATGTGTTGAAATATATAAAAAAAATCATATCAACAATCATTTTATGTATATATTAGTGCAAACGACAAATAACCACAAAATTCAAAATATAATTATACG
CGTATAATTATATTTTGAATTTTGTGGTTATTTGTCGTTTGCACTAATATATACATAAAATGATTGTTGATATGATTTTTTTTATATATTTCAACACATT[C/T,A]
TTCTAGATTCATATATAAAATTGAACTTATTTTAGGATGGAGAGTGTATGTCCGAGTCTGAATGTACTTTAGGGGCTGTTCAGATTTATGCCATTTTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.10% | 0.60% | 0.32% | 0.00% | A: 0.02% |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 97.90% | 1.30% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.00% | 2.50% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432237820 | G -> A | LOC_Os04g54080.1 | upstream_gene_variant ; 4180.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> A | LOC_Os04g54100.1 | upstream_gene_variant ; 2121.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> A | LOC_Os04g54110.1 | upstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> A | LOC_Os04g54090.1 | downstream_gene_variant ; 2799.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> A | LOC_Os04g54100-LOC_Os04g54110 | intergenic_region ; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> T | LOC_Os04g54080.1 | upstream_gene_variant ; 4180.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> T | LOC_Os04g54100.1 | upstream_gene_variant ; 2121.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> T | LOC_Os04g54110.1 | upstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> T | LOC_Os04g54090.1 | downstream_gene_variant ; 2799.0bp to feature; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0432237820 | G -> T | LOC_Os04g54100-LOC_Os04g54110 | intergenic_region ; MODIFIER | silent_mutation | Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432237820 | 7.15E-06 | 8.75E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 2.57E-06 | 5.34E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 8.86E-07 | 6.35E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 2.67E-06 | 6.91E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 1.22E-07 | 2.00E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 1.05E-06 | 1.50E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 8.19E-06 | 6.19E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 1.37E-08 | 3.75E-09 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 3.85E-06 | 2.49E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 6.49E-06 | 6.81E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 2.69E-09 | 5.55E-09 | mr1247 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 1.09E-08 | 8.57E-09 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 1.32E-06 | 1.32E-06 | mr1589 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 8.83E-06 | 8.83E-06 | mr1868 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 2.79E-08 | 1.55E-08 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432237820 | 7.93E-06 | 1.88E-06 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |