\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432237820:

Variant ID: vg0432237820 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32237820
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAAATGGCATAAATCTGAACAGCCCCTAAAGTACATTCAGACTCGGACATACACTCTCCATCCTAAAATAAGTTCAATTTTATATATGAATCTAGAA[G/A,T]
AATGTGTTGAAATATATAAAAAAAATCATATCAACAATCATTTTATGTATATATTAGTGCAAACGACAAATAACCACAAAATTCAAAATATAATTATACG

Reverse complement sequence

CGTATAATTATATTTTGAATTTTGTGGTTATTTGTCGTTTGCACTAATATATACATAAAATGATTGTTGATATGATTTTTTTTATATATTTCAACACATT[C/T,A]
TTCTAGATTCATATATAAAATTGAACTTATTTTAGGATGGAGAGTGTATGTCCGAGTCTGAATGTACTTTAGGGGCTGTTCAGATTTATGCCATTTTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.10% 0.60% 0.32% 0.00% A: 0.02%
All Indica  2759 99.60% 0.30% 0.07% 0.00% A: 0.04%
All Japonica  1512 97.90% 1.30% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 96.00% 2.50% 1.56% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432237820 G -> A LOC_Os04g54080.1 upstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> A LOC_Os04g54100.1 upstream_gene_variant ; 2121.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> A LOC_Os04g54110.1 upstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> A LOC_Os04g54090.1 downstream_gene_variant ; 2799.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> A LOC_Os04g54100-LOC_Os04g54110 intergenic_region ; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> T LOC_Os04g54080.1 upstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> T LOC_Os04g54100.1 upstream_gene_variant ; 2121.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> T LOC_Os04g54110.1 upstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> T LOC_Os04g54090.1 downstream_gene_variant ; 2799.0bp to feature; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0432237820 G -> T LOC_Os04g54100-LOC_Os04g54110 intergenic_region ; MODIFIER silent_mutation Average:38.956; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432237820 7.15E-06 8.75E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 2.57E-06 5.34E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 8.86E-07 6.35E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 2.67E-06 6.91E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 1.22E-07 2.00E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 1.05E-06 1.50E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 8.19E-06 6.19E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 1.37E-08 3.75E-09 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 3.85E-06 2.49E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 6.49E-06 6.81E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 2.69E-09 5.55E-09 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 1.09E-08 8.57E-09 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 1.32E-06 1.32E-06 mr1589 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 8.83E-06 8.83E-06 mr1868 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 2.79E-08 1.55E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432237820 7.93E-06 1.88E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251