\
| Variant ID: vg0432223443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32223443 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 277. )
CCATTTTTGAGCAACTCTCAGCAATGGATGAATCCACCAAATCCATGGCCTTGTCATCCTTCCATAAGCTCCATGCCTAAACAGTGAAATAGATCAGTCC[A/G]
TATAAAAGCGGTATAGTTATTTTGAATTTTTATGGACATAGAGCATTCCATGGTACTTACATAAGCTAATAGGTTGGGAAAGTCCATCAGCCGAGGTAAG
CTTACCTCGGCTGATGGACTTTCCCAACCTATTAGCTTATGTAAGTACCATGGAATGCTCTATGTCCATAAAAATTCAAAATAACTATACCGCTTTTATA[T/C]
GGACTGATCTATTTCACTGTTTAGGCATGGAGCTTATGGAAGGATGACAAGGCCATGGATTTGGTGGATTCATCCATTGCTGAGAGTTGCTCAAAAATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 19.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 26.00% | 73.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 12.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.10% | 81.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432223443 | A -> G | LOC_Os04g54060.1 | downstream_gene_variant ; 2563.0bp to feature; MODIFIER | silent_mutation | Average:48.725; most accessible tissue: Callus, score: 71.65 | N | N | N | N |
| vg0432223443 | A -> G | LOC_Os04g54070.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.725; most accessible tissue: Callus, score: 71.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432223443 | NA | 5.64E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 4.86E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 5.55E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 2.19E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 4.22E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.54E-07 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 8.24E-09 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 8.24E-06 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | 1.00E-07 | NA | mr1134_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 4.75E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 2.15E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.73E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.27E-10 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.18E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 7.72E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 4.97E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 6.41E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 4.00E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.29E-06 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 1.22E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432223443 | NA | 6.84E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |