\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432212716:

Variant ID: vg0432212716 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32212716
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCAAATTCTCGACTACAGCAAAACGGGAGACTTAGTCGTACGCTCTGTACTTTTTCGGTCGACATCAGAGATTCACTTAGACAAACCCTTTCGGTGCCC[A/G]
CACGGGGCTGACAAAGGAAGTCCAACATTATCTCTAAACTCACCGAGAACGGTCACATGAGCTTGATAACAGTTACTCCAATGTCTGCGCGCGGTTGAGA

Reverse complement sequence

TCTCAACCGCGCGCAGACATTGGAGTAACTGTTATCAAGCTCATGTGACCGTTCTCGGTGAGTTTAGAGATAATGTTGGACTTCCTTTGTCAGCCCCGTG[T/C]
GGGCACCGAAAGGGTTTGTCTAAGTGAATCTCTGATGTCGACCGAAAAAGTACAGAGCGTACGACTAAGTCTCCCGTTTTGCTGTAGTCGAGAATTTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 19.90% 0.87% 1.97% NA
All Indica  2759 94.20% 3.30% 0.91% 1.52% NA
All Japonica  1512 46.10% 53.60% 0.26% 0.00% NA
Aus  269 81.40% 3.00% 2.60% 13.01% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 96.80% 2.40% 0.00% 0.86% NA
Indica III  913 96.30% 0.70% 1.20% 1.86% NA
Indica Intermediate  786 93.00% 2.50% 1.78% 2.67% NA
Temperate Japonica  767 8.00% 92.00% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 34.90% 1.66% 0.00% NA
VI/Aromatic  96 78.10% 8.30% 1.04% 12.50% NA
Intermediate  90 68.90% 22.20% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432212716 A -> DEL N N silent_mutation Average:32.246; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0432212716 A -> G LOC_Os04g54060.1 upstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:32.246; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0432212716 A -> G LOC_Os04g54050.1 intron_variant ; MODIFIER silent_mutation Average:32.246; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432212716 NA 7.34E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 1.15E-16 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 1.15E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 3.33E-07 3.63E-07 mr1768 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 5.72E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 2.91E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 5.30E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 2.06E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 4.45E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 8.40E-21 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 5.54E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 5.42E-17 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 6.22E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 4.60E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 6.55E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 8.01E-16 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 2.74E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 1.14E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 8.36E-12 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 3.57E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 5.09E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 1.28E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212716 NA 3.97E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251