Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432212638:

Variant ID: vg0432212638 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32212638
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GAACGGTTGCTAGATCTTGACAAGGAATACGGACTGAAGAGATGGTGTACCCGCCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGACTACAGCAA[A/G]
ACGGGAGACTTAGTCGTACGCTCTGTACTTTTTCGGTCGACATCAGAGATTCACTTAGACAAACCCTTTCGGTGCCCACACGGGGCTGACAAAGGAAGTC

Reverse complement sequence

GACTTCCTTTGTCAGCCCCGTGTGGGCACCGAAAGGGTTTGTCTAAGTGAATCTCTGATGTCGACCGAAAAAGTACAGAGCGTACGACTAAGTCTCCCGT[T/C]
TTGCTGTAGTCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGGCGGGTACACCATCTCTTCAGTCCGTATTCCTTGTCAAGATCTAGCAACCGTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	19.90%	0.93%	1.97%	NA
All Indica	2759	94.30%	3.30%	0.87%	1.52%	NA
All Japonica	1512	45.80%	53.60%	0.53%	0.00%	NA
Aus	269	81.40%	3.00%	2.60%	13.01%	NA
Indica I	595	90.90%	9.10%	0.00%	0.00%	NA
Indica II	465	96.60%	2.60%	0.00%	0.86%	NA
Indica III	913	96.30%	0.70%	1.20%	1.86%	NA
Indica Intermediate	786	93.10%	2.50%	1.65%	2.67%	NA
Temperate Japonica	767	8.10%	91.90%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	4.20%	0.20%	0.00%	NA
Japonica Intermediate	241	61.80%	35.30%	2.90%	0.00%	NA
VI/Aromatic	96	78.10%	8.30%	1.04%	12.50%	NA
Intermediate	90	68.90%	22.20%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432212638	A -> DEL	N	N	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0432212638	A -> G	LOC_Os04g54060.1	upstream_gene_variant ; 2196.0bp to feature; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0432212638	A -> G	LOC_Os04g54050.1	intron_variant ; MODIFIER	silent_mutation	Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432212638	NA	6.91E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.22E-17	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	9.94E-13	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	3.08E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	9.05E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	5.84E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	3.36E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	1.17E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	8.93E-12	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.61E-26	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	6.16E-22	mr1115_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	4.03E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	8.81E-06	2.39E-17	mr1241_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	5.49E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	6.00E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	7.75E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.04E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	1.76E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	3.47E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	1.56E-23	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.27E-16	mr1611_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	7.69E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	5.21E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	1.19E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.03E-12	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	4.05E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	2.17E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	1.94E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	4.59E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638	NA	9.21E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251