\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432212638:

Variant ID: vg0432212638 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32212638
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAACGGTTGCTAGATCTTGACAAGGAATACGGACTGAAGAGATGGTGTACCCGCCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGACTACAGCAA[A/G]
ACGGGAGACTTAGTCGTACGCTCTGTACTTTTTCGGTCGACATCAGAGATTCACTTAGACAAACCCTTTCGGTGCCCACACGGGGCTGACAAAGGAAGTC

Reverse complement sequence

GACTTCCTTTGTCAGCCCCGTGTGGGCACCGAAAGGGTTTGTCTAAGTGAATCTCTGATGTCGACCGAAAAAGTACAGAGCGTACGACTAAGTCTCCCGT[T/C]
TTGCTGTAGTCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGGCGGGTACACCATCTCTTCAGTCCGTATTCCTTGTCAAGATCTAGCAACCGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 19.90% 0.93% 1.97% NA
All Indica  2759 94.30% 3.30% 0.87% 1.52% NA
All Japonica  1512 45.80% 53.60% 0.53% 0.00% NA
Aus  269 81.40% 3.00% 2.60% 13.01% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 96.60% 2.60% 0.00% 0.86% NA
Indica III  913 96.30% 0.70% 1.20% 1.86% NA
Indica Intermediate  786 93.10% 2.50% 1.65% 2.67% NA
Temperate Japonica  767 8.10% 91.90% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 61.80% 35.30% 2.90% 0.00% NA
VI/Aromatic  96 78.10% 8.30% 1.04% 12.50% NA
Intermediate  90 68.90% 22.20% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432212638 A -> DEL N N silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0432212638 A -> G LOC_Os04g54060.1 upstream_gene_variant ; 2196.0bp to feature; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg0432212638 A -> G LOC_Os04g54050.1 intron_variant ; MODIFIER silent_mutation Average:31.884; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432212638 NA 6.91E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.22E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 9.94E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 3.08E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 9.05E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 5.84E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 3.36E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 1.17E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 8.93E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.61E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 6.16E-22 mr1115_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 4.03E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 8.81E-06 2.39E-17 mr1241_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 5.49E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 6.00E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 7.75E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.04E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 1.76E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 3.47E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 1.56E-23 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.27E-16 mr1611_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 7.69E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 5.21E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 1.19E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.03E-12 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 4.05E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 2.17E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 1.94E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 4.59E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212638 NA 9.21E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251