\
| Variant ID: vg0432208373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32208373 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATGGCACTATTATTTAGTCTAAAATAGGATCTTTTCTTGGTCTTTGTTTAGGTTTTAATTGTTTGCGTACAGTTGCGGTTGCCGGATTTTCGTCGATC[G/A]
CGGGTTTTCTCGAAGATTCGTGAAGACCTTGAGCAAGGCAAGTCACCCTTTGACCAATTGCTCCTATAATTGGAAAATCATTATTATTTTGTTTGCAACT
AGTTGCAAACAAAATAATAATGATTTTCCAATTATAGGAGCAATTGGTCAAAGGGTGACTTGCCTTGCTCAAGGTCTTCACGAATCTTCGAGAAAACCCG[C/T]
GATCGACGAAAATCCGGCAACCGCAACTGTACGCAAACAATTAAAACCTAAACAAAGACCAAGAAAAGATCCTATTTTAGACTAAATAATAGTGCCATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 3.90% | 2.98% | 23.85% | NA |
| All Indica | 2759 | 65.50% | 1.80% | 2.90% | 29.72% | NA |
| All Japonica | 1512 | 71.40% | 8.40% | 3.17% | 17.06% | NA |
| Aus | 269 | 93.30% | 0.40% | 1.12% | 5.20% | NA |
| Indica I | 595 | 70.90% | 0.80% | 2.52% | 25.71% | NA |
| Indica II | 465 | 52.30% | 0.40% | 3.23% | 44.09% | NA |
| Indica III | 913 | 70.90% | 3.90% | 2.85% | 22.34% | NA |
| Indica Intermediate | 786 | 63.10% | 1.00% | 3.05% | 32.82% | NA |
| Temperate Japonica | 767 | 94.10% | 1.00% | 1.43% | 3.39% | NA |
| Tropical Japonica | 504 | 48.60% | 6.90% | 4.17% | 40.28% | NA |
| Japonica Intermediate | 241 | 46.50% | 34.90% | 6.64% | 12.03% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 6.25% | 13.54% | NA |
| Intermediate | 90 | 70.00% | 1.10% | 4.44% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432208373 | G -> DEL | N | N | silent_mutation | Average:6.938; most accessible tissue: Callus, score: 16.307 | N | N | N | N |
| vg0432208373 | G -> A | LOC_Os04g54040.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:6.938; most accessible tissue: Callus, score: 16.307 | N | N | N | N |
| vg0432208373 | G -> A | LOC_Os04g54050.1 | upstream_gene_variant ; 532.0bp to feature; MODIFIER | silent_mutation | Average:6.938; most accessible tissue: Callus, score: 16.307 | N | N | N | N |
| vg0432208373 | G -> A | LOC_Os04g54030.1 | downstream_gene_variant ; 2570.0bp to feature; MODIFIER | silent_mutation | Average:6.938; most accessible tissue: Callus, score: 16.307 | N | N | N | N |
| vg0432208373 | G -> A | LOC_Os04g54040-LOC_Os04g54050 | intergenic_region ; MODIFIER | silent_mutation | Average:6.938; most accessible tissue: Callus, score: 16.307 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432208373 | NA | 7.87E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432208373 | NA | 9.24E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432208373 | 1.92E-06 | 1.85E-08 | mr1177_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432208373 | NA | 2.60E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432208373 | NA | 2.42E-08 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |