\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432208373:

Variant ID: vg0432208373 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32208373
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATGGCACTATTATTTAGTCTAAAATAGGATCTTTTCTTGGTCTTTGTTTAGGTTTTAATTGTTTGCGTACAGTTGCGGTTGCCGGATTTTCGTCGATC[G/A]
CGGGTTTTCTCGAAGATTCGTGAAGACCTTGAGCAAGGCAAGTCACCCTTTGACCAATTGCTCCTATAATTGGAAAATCATTATTATTTTGTTTGCAACT

Reverse complement sequence

AGTTGCAAACAAAATAATAATGATTTTCCAATTATAGGAGCAATTGGTCAAAGGGTGACTTGCCTTGCTCAAGGTCTTCACGAATCTTCGAGAAAACCCG[C/T]
GATCGACGAAAATCCGGCAACCGCAACTGTACGCAAACAATTAAAACCTAAACAAAGACCAAGAAAAGATCCTATTTTAGACTAAATAATAGTGCCATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 3.90% 2.98% 23.85% NA
All Indica  2759 65.50% 1.80% 2.90% 29.72% NA
All Japonica  1512 71.40% 8.40% 3.17% 17.06% NA
Aus  269 93.30% 0.40% 1.12% 5.20% NA
Indica I  595 70.90% 0.80% 2.52% 25.71% NA
Indica II  465 52.30% 0.40% 3.23% 44.09% NA
Indica III  913 70.90% 3.90% 2.85% 22.34% NA
Indica Intermediate  786 63.10% 1.00% 3.05% 32.82% NA
Temperate Japonica  767 94.10% 1.00% 1.43% 3.39% NA
Tropical Japonica  504 48.60% 6.90% 4.17% 40.28% NA
Japonica Intermediate  241 46.50% 34.90% 6.64% 12.03% NA
VI/Aromatic  96 77.10% 3.10% 6.25% 13.54% NA
Intermediate  90 70.00% 1.10% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432208373 G -> DEL N N silent_mutation Average:6.938; most accessible tissue: Callus, score: 16.307 N N N N
vg0432208373 G -> A LOC_Os04g54040.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:6.938; most accessible tissue: Callus, score: 16.307 N N N N
vg0432208373 G -> A LOC_Os04g54050.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:6.938; most accessible tissue: Callus, score: 16.307 N N N N
vg0432208373 G -> A LOC_Os04g54030.1 downstream_gene_variant ; 2570.0bp to feature; MODIFIER silent_mutation Average:6.938; most accessible tissue: Callus, score: 16.307 N N N N
vg0432208373 G -> A LOC_Os04g54040-LOC_Os04g54050 intergenic_region ; MODIFIER silent_mutation Average:6.938; most accessible tissue: Callus, score: 16.307 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432208373 NA 7.87E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432208373 NA 9.24E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432208373 1.92E-06 1.85E-08 mr1177_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432208373 NA 2.60E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432208373 NA 2.42E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251