\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432204214:

Variant ID: vg0432204214 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32204214
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAGGTTGGACTTTGGAGGGAGCGGGCAGAGCAGGCGAAAGCCAAACCTCGCGTCTGTCCCATGGCGTGGCGGGTTCTCCTACCAGCGTTGGGTAGTA[C/T]
TTCCTCCGTATTAGGTTACACAAGTCGTTTAAATTTGTTGTCAAAATTAAACTATTTCAAATTTAATTAAGCTCATAGAAAAAAATAGAAACATTTTCAA

Reverse complement sequence

TTGAAAATGTTTCTATTTTTTTCTATGAGCTTAATTAAATTTGAAATAGTTTAATTTTGACAACAAATTTAAACGACTTGTGTAACCTAATACGGAGGAA[G/A]
TACTACCCAACGCTGGTAGGAGAACCCGCCACGCCATGGGACAGACGCGAGGTTTGGCTTTCGCCTGCTCTGCCCGCTCCCTCCAAAGTCCAACCTAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 17.90% 14.60% 36.10% NA
All Indica  2759 6.10% 22.80% 19.21% 51.90% NA
All Japonica  1512 66.50% 8.90% 9.39% 15.28% NA
Aus  269 77.00% 17.50% 2.23% 3.35% NA
Indica I  595 9.60% 12.30% 21.51% 56.64% NA
Indica II  465 3.70% 22.80% 15.70% 57.85% NA
Indica III  913 3.50% 29.40% 18.40% 48.74% NA
Indica Intermediate  786 7.80% 23.30% 20.48% 48.47% NA
Temperate Japonica  767 92.70% 1.40% 1.96% 3.91% NA
Tropical Japonica  504 37.50% 20.20% 18.45% 23.81% NA
Japonica Intermediate  241 43.60% 8.70% 14.11% 33.61% NA
VI/Aromatic  96 72.90% 18.80% 3.12% 5.21% NA
Intermediate  90 41.10% 16.70% 10.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432204214 C -> DEL N N silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N
vg0432204214 C -> T LOC_Os04g54020.1 upstream_gene_variant ; 1493.0bp to feature; MODIFIER silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N
vg0432204214 C -> T LOC_Os04g54030.1 upstream_gene_variant ; 1305.0bp to feature; MODIFIER silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N
vg0432204214 C -> T LOC_Os04g54050.1 upstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N
vg0432204214 C -> T LOC_Os04g54040.1 downstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N
vg0432204214 C -> T LOC_Os04g54020-LOC_Os04g54030 intergenic_region ; MODIFIER silent_mutation Average:48.981; most accessible tissue: Callus, score: 87.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432204214 3.12E-06 7.53E-06 mr1128 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 1.61E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 2.51E-07 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 8.69E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 4.48E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 3.42E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 3.65E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214 NA 3.42E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251