\
| Variant ID: vg0432204214 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 32204214 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 80. )
ATTTAGGTTGGACTTTGGAGGGAGCGGGCAGAGCAGGCGAAAGCCAAACCTCGCGTCTGTCCCATGGCGTGGCGGGTTCTCCTACCAGCGTTGGGTAGTA[C/T]
TTCCTCCGTATTAGGTTACACAAGTCGTTTAAATTTGTTGTCAAAATTAAACTATTTCAAATTTAATTAAGCTCATAGAAAAAAATAGAAACATTTTCAA
TTGAAAATGTTTCTATTTTTTTCTATGAGCTTAATTAAATTTGAAATAGTTTAATTTTGACAACAAATTTAAACGACTTGTGTAACCTAATACGGAGGAA[G/A]
TACTACCCAACGCTGGTAGGAGAACCCGCCACGCCATGGGACAGACGCGAGGTTTGGCTTTCGCCTGCTCTGCCCGCTCCCTCCAAAGTCCAACCTAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 17.90% | 14.60% | 36.10% | NA |
| All Indica | 2759 | 6.10% | 22.80% | 19.21% | 51.90% | NA |
| All Japonica | 1512 | 66.50% | 8.90% | 9.39% | 15.28% | NA |
| Aus | 269 | 77.00% | 17.50% | 2.23% | 3.35% | NA |
| Indica I | 595 | 9.60% | 12.30% | 21.51% | 56.64% | NA |
| Indica II | 465 | 3.70% | 22.80% | 15.70% | 57.85% | NA |
| Indica III | 913 | 3.50% | 29.40% | 18.40% | 48.74% | NA |
| Indica Intermediate | 786 | 7.80% | 23.30% | 20.48% | 48.47% | NA |
| Temperate Japonica | 767 | 92.70% | 1.40% | 1.96% | 3.91% | NA |
| Tropical Japonica | 504 | 37.50% | 20.20% | 18.45% | 23.81% | NA |
| Japonica Intermediate | 241 | 43.60% | 8.70% | 14.11% | 33.61% | NA |
| VI/Aromatic | 96 | 72.90% | 18.80% | 3.12% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 16.70% | 10.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0432204214 | C -> DEL | N | N | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| vg0432204214 | C -> T | LOC_Os04g54020.1 | upstream_gene_variant ; 1493.0bp to feature; MODIFIER | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| vg0432204214 | C -> T | LOC_Os04g54030.1 | upstream_gene_variant ; 1305.0bp to feature; MODIFIER | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| vg0432204214 | C -> T | LOC_Os04g54050.1 | upstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| vg0432204214 | C -> T | LOC_Os04g54040.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| vg0432204214 | C -> T | LOC_Os04g54020-LOC_Os04g54030 | intergenic_region ; MODIFIER | silent_mutation | Average:48.981; most accessible tissue: Callus, score: 87.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0432204214 | 3.12E-06 | 7.53E-06 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 1.61E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 2.51E-07 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 8.69E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 4.48E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 3.42E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 3.65E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0432204214 | NA | 3.42E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |