Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432161866:

Variant ID: vg0432161866 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32161866
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGTGCATATCATTCTGCATGCCACTCAAGTACTACATGATTTAATTAGCGCAACATCATATATATACTACAATGACAGCAGGCGTGCAAATAAAATA[T/C]
AATTTGTAGAGGTCAGAGGGTACGTGTGTAATTTGTGTTTAGATTGTGACGTTGAGTTTATCTTCTAGTGTGAAATGCTATACAATAAACTAAAGTTGAT

Reverse complement sequence

ATCAACTTTAGTTTATTGTATAGCATTTCACACTAGAAGATAAACTCAACGTCACAATCTAAACACAAATTACACACGTACCCTCTGACCTCTACAAATT[A/G]
TATTTTATTTGCACGCCTGCTGTCATTGTAGTATATATATGATGTTGCGCTAATTAAATCATGTAGTACTTGAGTGGCATGCAGAATGATATGCACATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 33.90% 0.36% 0.00% NA
All Indica  2759 90.00% 9.60% 0.43% 0.00% NA
All Japonica  1512 17.40% 82.50% 0.13% 0.00% NA
Aus  269 94.40% 4.80% 0.74% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 86.20% 13.10% 0.65% 0.00% NA
Indica III  913 93.20% 6.20% 0.55% 0.00% NA
Indica Intermediate  786 86.30% 13.40% 0.38% 0.00% NA
Temperate Japonica  767 7.40% 92.60% 0.00% 0.00% NA
Tropical Japonica  504 35.70% 64.10% 0.20% 0.00% NA
Japonica Intermediate  241 10.80% 88.80% 0.41% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432161866 T -> C LOC_Os04g53990.1 upstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:56.698; most accessible tissue: Minghui63 root, score: 97.195 N N N N
vg0432161866 T -> C LOC_Os04g53980.1 downstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:56.698; most accessible tissue: Minghui63 root, score: 97.195 N N N N
vg0432161866 T -> C LOC_Os04g53970-LOC_Os04g53980 intergenic_region ; MODIFIER silent_mutation Average:56.698; most accessible tissue: Minghui63 root, score: 97.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432161866 T C -0.08 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432161866 3.58E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432161866 5.30E-07 NA mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432161866 4.56E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432161866 1.13E-06 NA mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432161866 2.39E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432161866 7.69E-06 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251