Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432077668:

Variant ID: vg0432077668 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32077668
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.12, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TTACCTACCGTCCCCTCTCTCGATCGGCTTACGGACAATGCGTATGACGCACGCCCGGATTAACGTCAGTTGTAAGTCGATGGTCGGCCATGAATCTACA[T/G]
GTCAGTCCAGACGCACGAATGCATGACTCAGGTCCAGTTCTTTTCTTCCACAAGACTTAGATAAATATTAAGATTTTCGTGACACGCTTTTCAAACTGTT

Reverse complement sequence

AACAGTTTGAAAAGCGTGTCACGAAAATCTTAATATTTATCTAAGTCTTGTGGAAGAAAAGAACTGGACCTGAGTCATGCATTCGTGCGTCTGGACTGAC[A/C]
TGTAGATTCATGGCCGACCATCGACTTACAACTGACGTTAATCCGGGCGTGCGTCATACGCATTGTCCGTAAGCCGATCGAGAGAGGGGACGGTAGGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 39.30% 0.42% 13.77% NA
All Indica  2759 47.80% 41.90% 0.43% 9.82% NA
All Japonica  1512 39.70% 38.00% 0.40% 21.89% NA
Aus  269 61.30% 27.50% 0.74% 10.41% NA
Indica I  595 68.40% 29.60% 0.50% 1.51% NA
Indica II  465 33.80% 47.50% 0.65% 18.06% NA
Indica III  913 34.80% 55.80% 0.11% 9.31% NA
Indica Intermediate  786 55.60% 31.90% 0.64% 11.83% NA
Temperate Japonica  767 49.80% 48.90% 0.13% 1.17% NA
Tropical Japonica  504 14.70% 23.00% 0.99% 61.31% NA
Japonica Intermediate  241 60.20% 34.40% 0.00% 5.39% NA
VI/Aromatic  96 75.00% 20.80% 0.00% 4.17% NA
Intermediate  90 47.80% 33.30% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432077668 T -> DEL N N silent_mutation Average:54.763; most accessible tissue: Zhenshan97 root, score: 98.501 N N N N
vg0432077668 T -> G LOC_Os04g53830.1 upstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:54.763; most accessible tissue: Zhenshan97 root, score: 98.501 N N N N
vg0432077668 T -> G LOC_Os04g53820.1 downstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:54.763; most accessible tissue: Zhenshan97 root, score: 98.501 N N N N
vg0432077668 T -> G LOC_Os04g53820-LOC_Os04g53830 intergenic_region ; MODIFIER silent_mutation Average:54.763; most accessible tissue: Zhenshan97 root, score: 98.501 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432077668 T G 0.15 0.2 0.19 0.11 0.14 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432077668 NA 6.96E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432077668 7.73E-07 1.97E-07 mr1265_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432077668 NA 3.11E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251