\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432065258:

Variant ID: vg0432065258 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32065258
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCGCCGAGATCTTCGTCGCCGAGGAGGAGTCGGCGTCGGGGAGGTACATCTGCGGCAGCCTCAACACCACGGTCACCGAGATCGCCGGCTTCCTGGC[G/T]
GCCAAGTACCCCCAGTACAACGTCAGATGCGATTGGTAATTAAGAAATTAAGCTTTATGCATTCGTGCATTTGGTTATCTGAATCTGATCATGCGTTGCT

Reverse complement sequence

AGCAACGCATGATCAGATTCAGATAACCAAATGCACGAATGCATAAAGCTTAATTTCTTAATTACCAATCGCATCTGACGTTGTACTGGGGGTACTTGGC[C/A]
GCCAGGAAGCCGGCGATCTCGGTGACCGTGGTGTTGAGGCTGCCGCAGATGTACCTCCCCGACGCCGACTCCTCCTCGGCGACGAAGATCTCGGCGCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.20% 0.11% 0.00% NA
All Indica  2759 53.60% 46.20% 0.18% 0.00% NA
All Japonica  1512 75.10% 24.90% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 35.80% 64.20% 0.00% 0.00% NA
Indica II  465 58.10% 41.90% 0.00% 0.00% NA
Indica III  913 67.30% 32.50% 0.22% 0.00% NA
Indica Intermediate  786 48.60% 51.00% 0.38% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 31.20% 68.80% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432065258 G -> T LOC_Os04g53810.1 synonymous_variant ; p.Ala285Ala; LOW synonymous_codon Average:86.754; most accessible tissue: Zhenshan97 flag leaf, score: 97.355 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432065258 G T 0.01 -0.01 0.01 0.01 0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432065258 NA 8.10E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 1.41E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 4.40E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 2.73E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 4.48E-06 1.81E-14 mr1241_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 8.53E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 4.38E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 2.01E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432065258 NA 2.25E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251