Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432040936:

Variant ID: vg0432040936 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32040936
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGCTAGCTAAGCGTACGTTTCTGATTAATGATAGATTCTAGAAAAAGAAAACAGGTCCCATATCGATCAAGCGGGCTGATTTAATACTCCCTCCTTCTC[A/T]
AAATGTTTCCGTTGACTTTTTTAAATATGTTTGTACATGACTCCATAGAACGATGACGACGACGTCTGTGCTGCAACCAGAAAAATACAAGAGAAGAAAC

Reverse complement sequence

GTTTCTTCTCTTGTATTTTTCTGGTTGCAGCACAGACGTCGTCGTCATCGTTCTATGGAGTCATGTACAAACATATTTAAAAAAGTCAACGGAAACATTT[T/A]
GAGAAGGAGGGAGTATTAAATCAGCCCGCTTGATCGATATGGGACCTGTTTTCTTTTTCTAGAATCTATCATTAATCAGAAACGTACGCTTAGCTAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	44.40%	4.10%	4.46%	NA
All Indica	2759	31.90%	53.90%	6.67%	7.50%	NA
All Japonica	1512	71.90%	27.70%	0.26%	0.13%	NA
Aus	269	62.80%	36.10%	1.12%	0.00%	NA
Indica I	595	31.10%	52.30%	11.43%	5.21%	NA
Indica II	465	44.30%	44.70%	4.52%	6.45%	NA
Indica III	913	31.70%	53.80%	4.93%	9.64%	NA
Indica Intermediate	786	25.40%	60.80%	6.36%	7.38%	NA
Temperate Japonica	767	94.70%	5.20%	0.13%	0.00%	NA
Tropical Japonica	504	29.60%	69.40%	0.60%	0.40%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	47.80%	46.70%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432040936	A -> DEL	N	N	silent_mutation	Average:92.51; most accessible tissue: Minghui63 young leaf, score: 96.619	N	N	N	N
vg0432040936	A -> T	LOC_Os04g53760.1	upstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:92.51; most accessible tissue: Minghui63 young leaf, score: 96.619	N	N	N	N
vg0432040936	A -> T	LOC_Os04g53770.1	upstream_gene_variant ; 2597.0bp to feature; MODIFIER	silent_mutation	Average:92.51; most accessible tissue: Minghui63 young leaf, score: 96.619	N	N	N	N
vg0432040936	A -> T	LOC_Os04g53760.2	upstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:92.51; most accessible tissue: Minghui63 young leaf, score: 96.619	N	N	N	N
vg0432040936	A -> T	LOC_Os04g53760-LOC_Os04g53770	intergenic_region ; MODIFIER	silent_mutation	Average:92.51; most accessible tissue: Minghui63 young leaf, score: 96.619	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0432040936	A	T	0.04	0.02	0.02	0.0	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432040936	NA	6.71E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	2.16E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	5.41E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	7.20E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	7.32E-07	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	2.46E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	1.57E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	7.97E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432040936	NA	5.61E-06	mr1815_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251