Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432023793:

Variant ID: vg0432023793 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32023793
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCGGCACCGCCGCGTGTCGGCCATCAGCGAGACAGCGACACCTCCAAGGCTCCAATGCCCAGCAGCCCCTCTCTCATCCATGGTAGTGCTCTGTCAT[G/A]
GTGTACGGGAATGACAGGGTTGGCTGCTCCACTAAAAATACGCGCGGAGACCCCCATGAGGAGCAGATCGAGGGTACCTGCATCGCTCCTTTCTTTCTTT

Reverse complement sequence

AAAGAAAGAAAGGAGCGATGCAGGTACCCTCGATCTGCTCCTCATGGGGGTCTCCGCGCGTATTTTTAGTGGAGCAGCCAACCCTGTCATTCCCGTACAC[C/T]
ATGACAGAGCACTACCATGGATGAGAGAGGGGCTGCTGGGCATTGGAGCCTTGGAGGTGTCGCTGTCTCGCTGATGGCCGACACGCGGCGGTGCCGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 20.30% 1.08% 21.73% NA
All Indica  2759 32.40% 30.30% 1.74% 35.52% NA
All Japonica  1512 95.00% 3.00% 0.07% 1.92% NA
Aus  269 80.70% 17.80% 0.74% 0.74% NA
Indica I  595 20.00% 23.20% 0.50% 56.30% NA
Indica II  465 53.80% 24.70% 0.00% 21.51% NA
Indica III  913 22.50% 46.40% 3.07% 28.04% NA
Indica Intermediate  786 40.70% 20.40% 2.16% 36.77% NA
Temperate Japonica  767 99.00% 0.90% 0.00% 0.13% NA
Tropical Japonica  504 88.50% 6.50% 0.20% 4.76% NA
Japonica Intermediate  241 95.90% 2.50% 0.00% 1.66% NA
VI/Aromatic  96 85.40% 13.50% 0.00% 1.04% NA
Intermediate  90 67.80% 15.60% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432023793 G -> DEL N N silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N
vg0432023793 G -> A LOC_Os04g53740.1 upstream_gene_variant ; 1066.0bp to feature; MODIFIER silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N
vg0432023793 G -> A LOC_Os04g53750.1 upstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N
vg0432023793 G -> A LOC_Os04g53750.3 upstream_gene_variant ; 65.0bp to feature; MODIFIER silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N
vg0432023793 G -> A LOC_Os04g53750.4 upstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N
vg0432023793 G -> A LOC_Os04g53740-LOC_Os04g53750 intergenic_region ; MODIFIER silent_mutation Average:67.179; most accessible tissue: Callus, score: 99.875 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432023793 G A -0.2 -0.17 -0.15 -0.12 -0.16 -0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432023793 2.01E-06 2.01E-06 mr1507 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432023793 NA 5.97E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432023793 3.95E-06 3.95E-06 mr1854 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432023793 7.45E-06 7.45E-06 mr1894 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432023793 NA 5.47E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251