\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432022826:

Variant ID: vg0432022826 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 32022826
Reference Allele: TCTAAAATATAATCAAlternative Allele: T,CCTAAAATATAATCA,TTAAAATATAATCA,ACTAAAATATAATCA
Primary Allele: TCTAAAATATAATCASecondary Allele: CCTAAAATATAATCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGATGGGCTAGCTGGCAATCGCATAGTGGGGGCACCTCTCTCATTCTCGCTTTTCCTTTTTTTTTTATTTAAGAAAATAGATTTACTACTTCCTCCGT[TCTAAAATATAATCA/T,CCTAAAATATAATCA,TTAAAATATAATCA,ACTAAAATATAATCA]
TTTTTAGAATTCATAGCTAAAAGTTACTGTATTTTGAGACGGATATAGTCATTGAACGGATTATGCAACGGATAGGAGCATATACTTGCATATAGGAATA

Reverse complement sequence

TATTCCTATATGCAAGTATATGCTCCTATCCGTTGCATAATCCGTTCAATGACTATATCCGTCTCAAAATACAGTAACTTTTAGCTATGAATTCTAAAAA[TGATTATATTTTAGA/A,TGATTATATTTTAGG,TGATTATATTTTAA,TGATTATATTTTAGT]
ACGGAGGAAGTAGTAAATCTATTTTCTTAAATAAAAAAAAAAGGAAAAGCGAGAATGAGAGAGGTGCCCCCACTATGCGATTGCCAGCTAGCCCATCACA

Allele Frequencies:

Populations Population SizeFrequency of TCTAAAATATAATCA(primary allele) Frequency of CCTAAAATATAATCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 10.10% 0.47% 0.76% T: 1.04%; TTAAAATATAATCA: 0.02%; ACTAAAATATAATCA: 0.02%
All Indica  2759 81.00% 15.30% 0.72% 1.30% T: 1.67%; TTAAAATATAATCA: 0.04%; ACTAAAATATAATCA: 0.04%
All Japonica  1512 98.90% 1.00% 0.07% 0.00% T: 0.07%
Aus  269 91.80% 7.10% 0.37% 0.00% T: 0.74%
Indica I  595 93.10% 5.50% 0.50% 0.17% T: 0.67%
Indica II  465 48.60% 50.30% 0.43% 0.22% T: 0.22%; ACTAAAATATAATCA: 0.22%
Indica III  913 91.60% 2.70% 0.77% 1.86% T: 2.96%; TTAAAATATAATCA: 0.11%
Indica Intermediate  786 78.60% 16.40% 1.02% 2.16% T: 1.78%
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53730.1 upstream_gene_variant ; 4424.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53740.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53750.1 upstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53750.3 upstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53750.4 upstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> CCTAAAATATAATCA LOC_Os04g53740-LOC_Os04g53750 intergenic_region ; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> DEL N N silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53730.1 upstream_gene_variant ; 4424.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53740.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53750.1 upstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53750.3 upstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53750.4 upstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> ACTAAAATATAATCA LOC_Os04g53740-LOC_Os04g53750 intergenic_region ; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53730.1 upstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53740.1 upstream_gene_variant ; 100.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53750.1 upstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53750.3 upstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53750.4 upstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> TTAAAATATAATCA LOC_Os04g53740-LOC_Os04g53750 intergenic_region ; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53730.1 upstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53740.1 upstream_gene_variant ; 100.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53750.1 upstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53750.3 upstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53750.4 upstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg0432022826 TCTAAAATATAATCA -> T LOC_Os04g53740-LOC_Os04g53750 intergenic_region ; MODIFIER silent_mutation Average:91.522; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432022826 TCTAA* ACTAA* 0.05 0.03 0.02 0.02 0.02 0.01
vg0432022826 TCTAA* CCTAA* -0.01 0.01 0.01 -0.02 0.0 -0.01
vg0432022826 TCTAA* T 0.19 0.17 0.03 0.1 0.23 0.28
vg0432022826 TCTAA* TTAAA* 0.03 -0.03 -0.05 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432022826 NA 1.64E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 3.62E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 1.24E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 1.55E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 1.38E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 8.11E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 8.65E-13 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 5.55E-09 mr1319_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 7.23E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 2.79E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 7.55E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 2.75E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 1.54E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 4.55E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432022826 NA 8.32E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251