\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431920149:

Variant ID: vg0431920149 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31920149
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTCTTCAAACTTCTAAATTTTCCATCATATCAAAATTTTCCTACACACATAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAACTTC[C/T]
AATTTTAGCGTGAACTAAACACAGCATATGTCTAGTAGGAGTGGTTCTTGACATTCTTGTGATCATAATTGGGATAGTAGTATGTACTCCATCAAATTGT

Reverse complement sequence

ACAATTTGATGGAGTACATACTACTATCCCAATTATGATCACAAGAATGTCAAGAACCACTCCTACTAGACATATGCTGTGTTTAGTTCACGCTAAAATT[G/A]
GAAGTTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTATGTGTGTAGGAAAATTTTGATATGATGGAAAATTTAGAAGTTTGAAGAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 24.80% 0.15% 0.32% NA
All Indica  2759 78.50% 21.30% 0.11% 0.07% NA
All Japonica  1512 64.90% 34.10% 0.13% 0.86% NA
Aus  269 81.40% 17.80% 0.74% 0.00% NA
Indica I  595 85.00% 14.80% 0.00% 0.17% NA
Indica II  465 54.20% 45.80% 0.00% 0.00% NA
Indica III  913 87.10% 12.80% 0.00% 0.11% NA
Indica Intermediate  786 78.10% 21.50% 0.38% 0.00% NA
Temperate Japonica  767 47.20% 51.00% 0.26% 1.56% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 71.40% 28.20% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431920149 C -> DEL N N silent_mutation Average:67.129; most accessible tissue: Minghui63 flower, score: 82.637 N N N N
vg0431920149 C -> T LOC_Os04g53544-LOC_Os04g53550 intergenic_region ; MODIFIER silent_mutation Average:67.129; most accessible tissue: Minghui63 flower, score: 82.637 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431920149 C T 0.03 0.03 0.01 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431920149 NA 2.13E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 3.45E-09 mr1352 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 9.14E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 7.15E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 4.55E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 6.19E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 1.92E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431920149 NA 5.27E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251