\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431894969:

Variant ID: vg0431894969 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31894969
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGATTTCTTATATAGTTACAAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTTGACAATTTTATCAAAACTTGGTAATATTGAAAATGTCATCAAA[G/A]
TGAAGAGGCCTAAAAATATACTATTCAAAGTGCCAAACAATTTGATAGCACATATTTTAGCTTCAAACCAAAATGGCCTTAAGTTTTTCTAAAAGACCAA

Reverse complement sequence

TTGGTCTTTTAGAAAAACTTAAGGCCATTTTGGTTTGAAGCTAAAATATGTGCTATCAAATTGTTTGGCACTTTGAATAGTATATTTTTAGGCCTCTTCA[C/T]
TTTGATGACATTTTCAATATTACCAAGTTTTGATAAAATTGTCAAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTTGTAACTATATAAGAAATCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 3.20% 0.02% 0.00% NA
All Indica  2759 95.50% 4.50% 0.04% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 92.90% 6.90% 0.22% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431894969 G -> A LOC_Os04g53520.1 upstream_gene_variant ; 394.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53530.1 upstream_gene_variant ; 283.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53540.1 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53540.4 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53540.2 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53540.3 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894969 G -> A LOC_Os04g53520-LOC_Os04g53530 intergenic_region ; MODIFIER silent_mutation Average:64.141; most accessible tissue: Callus, score: 95.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431894969 NA 7.07E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 NA 4.54E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 8.59E-06 8.59E-06 mr1384_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 NA 3.69E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 3.08E-06 1.59E-10 mr1711_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 NA 6.89E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 NA 1.41E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 9.47E-06 1.87E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894969 NA 8.53E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251