\
| Variant ID: vg0431894969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31894969 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGATTTCTTATATAGTTACAAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTTGACAATTTTATCAAAACTTGGTAATATTGAAAATGTCATCAAA[G/A]
TGAAGAGGCCTAAAAATATACTATTCAAAGTGCCAAACAATTTGATAGCACATATTTTAGCTTCAAACCAAAATGGCCTTAAGTTTTTCTAAAAGACCAA
TTGGTCTTTTAGAAAAACTTAAGGCCATTTTGGTTTGAAGCTAAAATATGTGCTATCAAATTGTTTGGCACTTTGAATAGTATATTTTTAGGCCTCTTCA[C/T]
TTTGATGACATTTTCAATATTACCAAGTTTTGATAAAATTGTCAAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTTGTAACTATATAAGAAATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 3.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 6.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431894969 | G -> A | LOC_Os04g53520.1 | upstream_gene_variant ; 394.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53530.1 | upstream_gene_variant ; 283.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53540.1 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53540.4 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53540.2 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53540.3 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| vg0431894969 | G -> A | LOC_Os04g53520-LOC_Os04g53530 | intergenic_region ; MODIFIER | silent_mutation | Average:64.141; most accessible tissue: Callus, score: 95.185 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431894969 | NA | 7.07E-06 | mr1252_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | NA | 4.54E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | 8.59E-06 | 8.59E-06 | mr1384_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | NA | 3.69E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | 3.08E-06 | 1.59E-10 | mr1711_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | NA | 6.89E-06 | mr1837_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | NA | 1.41E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | 9.47E-06 | 1.87E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431894969 | NA | 8.53E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |