\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431894928:

Variant ID: vg0431894928 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31894928
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCAATGCCAAAAATTTGGTATAGTTGCTAAAATTTTGGCATGATTTCTTATATAGTTACAAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTTGA[C/T]
AATTTTATCAAAACTTGGTAATATTGAAAATGTCATCAAAGTGAAGAGGCCTAAAAATATACTATTCAAAGTGCCAAACAATTTGATAGCACATATTTTA

Reverse complement sequence

TAAAATATGTGCTATCAAATTGTTTGGCACTTTGAATAGTATATTTTTAGGCCTCTTCACTTTGATGACATTTTCAATATTACCAAGTTTTGATAAAATT[G/A]
TCAAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTTGTAACTATATAAGAAATCATGCCAAAATTTTAGCAACTATACCAAATTTTTGGCATTGCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.30% 0.04% 0.00% NA
All Indica  2759 92.20% 7.70% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 89.40% 10.50% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 6.00% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431894928 C -> T LOC_Os04g53520.1 upstream_gene_variant ; 353.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53530.1 upstream_gene_variant ; 324.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53540.1 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53540.4 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53540.2 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53540.3 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894928 C -> T LOC_Os04g53520-LOC_Os04g53530 intergenic_region ; MODIFIER silent_mutation Average:55.516; most accessible tissue: Callus, score: 95.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431894928 NA 1.95E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 8.48E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 7.22E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 9.34E-06 2.34E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 5.86E-06 5.86E-06 mr1209_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 1.54E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 9.71E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 6.25E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 8.91E-06 8.91E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 1.48E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 3.24E-06 3.24E-06 mr1384_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 7.07E-06 7.07E-06 mr1405_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 1.21E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 8.38E-06 8.38E-06 mr1475_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 3.53E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 3.38E-06 3.30E-10 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 4.93E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 7.40E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 6.53E-06 NA mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 6.41E-06 1.70E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 8.21E-07 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 3.27E-06 9.17E-09 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 8.57E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 5.68E-06 mr1922_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 3.39E-06 4.16E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894928 NA 5.52E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251