\
| Variant ID: vg0431889500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31889500 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 55. )
CGGGAGACCTCCAAGCTTTCATGACAAGGCATTTCCAAAGCCGACACAGGTTTACCATATGCCGACGAGAGGGGTCCCAGACCAACAACAGGTTAGGTCC[T/C]
AGACCATACTGTGCCAGGAAGCCTAGGGGTCCTCCCTGACACCACCCCGGCAAATCCACAAGTCTCTCGGCATCAAGGCTCCCCTGATAAGCTAGTTACT
AGTAACTAGCTTATCAGGGGAGCCTTGATGCCGAGAGACTTGTGGATTTGCCGGGGTGGTGTCAGGGAGGACCCCTAGGCTTCCTGGCACAGTATGGTCT[A/G]
GGACCTAACCTGTTGTTGGTCTGGGACCCCTCTCGTCGGCATATGGTAAACCTGTGTCGGCTTTGGAAATGCCTTGTCATGAAAGCTTGGAGGTCTCCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 15.70% | 11.40% | 20.36% | 52.62% | NA |
| All Indica | 2759 | 7.40% | 11.40% | 28.05% | 53.17% | NA |
| All Japonica | 1512 | 33.70% | 13.30% | 6.35% | 46.63% | NA |
| Aus | 269 | 4.10% | 4.50% | 17.47% | 73.98% | NA |
| Indica I | 595 | 9.70% | 5.50% | 16.97% | 67.73% | NA |
| Indica II | 465 | 9.50% | 3.40% | 16.56% | 70.54% | NA |
| Indica III | 913 | 6.80% | 19.70% | 42.39% | 31.11% | NA |
| Indica Intermediate | 786 | 5.10% | 10.80% | 26.59% | 57.51% | NA |
| Temperate Japonica | 767 | 52.00% | 25.30% | 10.82% | 11.86% | NA |
| Tropical Japonica | 504 | 7.70% | 0.80% | 0.60% | 90.87% | NA |
| Japonica Intermediate | 241 | 29.90% | 1.20% | 4.15% | 64.73% | NA |
| VI/Aromatic | 96 | 0.00% | 1.00% | 27.08% | 71.88% | NA |
| Intermediate | 90 | 16.70% | 10.00% | 21.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431889500 | T -> C | LOC_Os04g53520.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.031; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg0431889500 | T -> DEL | N | N | silent_mutation | Average:9.031; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431889500 | NA | 8.81E-07 | mr1063 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | 9.10E-06 | 9.09E-06 | mr1122 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | NA | 8.14E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | 8.11E-08 | 2.58E-07 | mr1318 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | 3.00E-06 | 1.02E-08 | mr1318 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | NA | 5.23E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | NA | 5.96E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | NA | 1.17E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431889500 | NA | 1.53E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |