\
| Variant ID: vg0431867782 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31867782 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )
GCGGTTACAACAGGCACGCCCCTCTATTTATGAGAGATCCTAGGATAAAATCCGACTCATACTCTAGTCCTACACTTAGTACAACTCCAAGTCCTAAACT[G/A]
TAACCGACTACGTACACATATTCGACACAAACTCTAACAAACTCCACCTTGGCGAATATGCCACGCCAACCTGAATTCATTACTTGCTCGAACCTCCATG
CATGGAGGTTCGAGCAAGTAATGAATTCAGGTTGGCGTGGCATATTCGCCAAGGTGGAGTTTGTTAGAGTTTGTGTCGAATATGTGTACGTAGTCGGTTA[C/T]
AGTTTAGGACTTGGAGTTGTACTAAGTGTAGGACTAGAGTATGAGTCGGATTTTATCCTAGGATCTCTCATAAATAGAGGGGCGTGCCTGTTGTAACCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 21.30% | 6.12% | 4.06% | NA |
| All Indica | 2759 | 74.20% | 10.10% | 10.08% | 5.69% | NA |
| All Japonica | 1512 | 62.70% | 34.70% | 0.46% | 2.18% | NA |
| Aus | 269 | 43.50% | 56.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 65.40% | 3.90% | 13.78% | 16.97% | NA |
| Indica II | 465 | 81.10% | 8.20% | 8.82% | 1.94% | NA |
| Indica III | 913 | 77.40% | 14.20% | 6.79% | 1.53% | NA |
| Indica Intermediate | 786 | 72.90% | 11.10% | 11.83% | 4.20% | NA |
| Temperate Japonica | 767 | 89.20% | 10.30% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 32.70% | 60.70% | 1.19% | 5.36% | NA |
| Japonica Intermediate | 241 | 41.10% | 57.70% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 17.80% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431867782 | G -> DEL | N | N | silent_mutation | Average:49.411; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0431867782 | G -> A | LOC_Os04g53496-LOC_Os04g53510 | intergenic_region ; MODIFIER | silent_mutation | Average:49.411; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431867782 | NA | 6.52E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431867782 | NA | 2.40E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431867782 | NA | 9.27E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 4.52E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 4.56E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 5.85E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | 4.51E-06 | NA | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 5.56E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 1.05E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 2.17E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 3.93E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 9.61E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 8.86E-07 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431867782 | NA | 8.02E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |