\
| Variant ID: vg0431866383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31866383 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.04, others allele: 0.00, population size: 300. )
AACAAAAGGCTTAGTTCAATGAACATAAATGACTGGAATTATTGCAATGAACGTCCAAACAGTCTAGCTCCTTCCCTTTATATGGTGAGTGCTATACAAC[T/C]
TGTTCTAGTTCTTTCAAACTTTAGTAGCTACTGCAAAGTATTTACTCTGTTGAGAAGTACTTACATTTTTGTTGTCCACTTTGGCAGAAGAAGACATAAT
ATTATGTCTTCTTCTGCCAAAGTGGACAACAAAAATGTAAGTACTTCTCAACAGAGTAAATACTTTGCAGTAGCTACTAAAGTTTGAAAGAACTAGAACA[A/G]
GTTGTATAGCACTCACCATATAAAGGGAAGGAGCTAGACTGTTTGGACGTTCATTGCAATAATTCCAGTCATTTATGTTCATTGAACTAAGCCTTTTGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 25.80% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 61.00% | 38.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.90% | 31.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 46.50% | 53.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 67.60% | 32.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 56.60% | 43.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 26.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431866383 | T -> C | LOC_Os04g53496.1 | downstream_gene_variant ; 4097.0bp to feature; MODIFIER | silent_mutation | Average:47.859; most accessible tissue: Callus, score: 63.795 | N | N | N | N |
| vg0431866383 | T -> C | LOC_Os04g53496-LOC_Os04g53510 | intergenic_region ; MODIFIER | silent_mutation | Average:47.859; most accessible tissue: Callus, score: 63.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431866383 | NA | 2.68E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | NA | 6.15E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | 2.48E-06 | 3.09E-07 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | 9.73E-06 | 3.78E-08 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | NA | 1.78E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | NA | 5.73E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | 6.11E-06 | NA | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431866383 | NA | 2.35E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |