Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431866383:

Variant ID: vg0431866383 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31866383
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.04, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

AACAAAAGGCTTAGTTCAATGAACATAAATGACTGGAATTATTGCAATGAACGTCCAAACAGTCTAGCTCCTTCCCTTTATATGGTGAGTGCTATACAAC[T/C]
TGTTCTAGTTCTTTCAAACTTTAGTAGCTACTGCAAAGTATTTACTCTGTTGAGAAGTACTTACATTTTTGTTGTCCACTTTGGCAGAAGAAGACATAAT

Reverse complement sequence

ATTATGTCTTCTTCTGCCAAAGTGGACAACAAAAATGTAAGTACTTCTCAACAGAGTAAATACTTTGCAGTAGCTACTAAAGTTTGAAAGAACTAGAACA[A/G]
GTTGTATAGCACTCACCATATAAAGGGAAGGAGCTAGACTGTTTGGACGTTCATTGCAATAATTCCAGTCATTTATGTTCATTGAACTAAGCCTTTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	25.80%	0.30%	0.00%	NA
All Indica	2759	61.00%	38.70%	0.36%	0.00%	NA
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	71.40%	28.60%	0.00%	0.00%	NA
Indica I	595	67.90%	31.80%	0.34%	0.00%	NA
Indica II	465	46.50%	53.10%	0.43%	0.00%	NA
Indica III	913	67.60%	32.10%	0.33%	0.00%	NA
Indica Intermediate	786	56.60%	43.00%	0.38%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	17.70%	1.04%	0.00%	NA
Intermediate	90	70.00%	26.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431866383	T -> C	LOC_Os04g53496.1	downstream_gene_variant ; 4097.0bp to feature; MODIFIER	silent_mutation	Average:47.859; most accessible tissue: Callus, score: 63.795	N	N	N	N
vg0431866383	T -> C	LOC_Os04g53496-LOC_Os04g53510	intergenic_region ; MODIFIER	silent_mutation	Average:47.859; most accessible tissue: Callus, score: 63.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431866383	NA	2.68E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	NA	6.15E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	2.48E-06	3.09E-07	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	9.73E-06	3.78E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	NA	1.78E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	NA	5.73E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	6.11E-06	NA	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431866383	NA	2.35E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251