\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431851987:

Variant ID: vg0431851987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31851987
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCGCCAGAGCGCCACTACCGCCGCCGCCGCCGATGCCTTGCTCCCCTGCTCCCGTGTCGTCGCCGGCCACCGGACCTCCTCTCCCGCCTCGCCCCATC[G/A]
GTCTCCTCCCTACCTGGTGGTCGGCCTGCCCAGAGCCCAAGAGAGAAGAGTGAGAGAGAGAGAGAGAGGAGGAAGGGAGAGAAGAGGGGAAAGAGAGAGA

Reverse complement sequence

TCTCTCTCTTTCCCCTCTTCTCTCCCTTCCTCCTCTCTCTCTCTCTCTCACTCTTCTCTCTTGGGCTCTGGGCAGGCCGACCACCAGGTAGGGAGGAGAC[C/T]
GATGGGGCGAGGCGGGAGAGGAGGTCCGGTGGCCGGCGACGACACGGGAGCAGGGGAGCAAGGCATCGGCGGCGGCGGCGGTAGTGGCGCTCTGGCGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 18.80% 0.28% 0.00% NA
All Indica  2759 93.90% 5.80% 0.29% 0.00% NA
All Japonica  1512 62.90% 36.90% 0.20% 0.00% NA
Aus  269 62.80% 36.40% 0.74% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 91.10% 8.80% 0.11% 0.00% NA
Indica Intermediate  786 92.90% 6.20% 0.89% 0.00% NA
Temperate Japonica  767 89.40% 10.30% 0.26% 0.00% NA
Tropical Japonica  504 33.70% 66.10% 0.20% 0.00% NA
Japonica Intermediate  241 39.40% 60.60% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431851987 G -> A LOC_Os04g53490.1 upstream_gene_variant ; 1119.0bp to feature; MODIFIER silent_mutation Average:75.364; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0431851987 G -> A LOC_Os04g53496.1 upstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:75.364; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0431851987 G -> A LOC_Os04g53490-LOC_Os04g53496 intergenic_region ; MODIFIER silent_mutation Average:75.364; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431851987 G A -0.02 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431851987 NA 2.14E-10 Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431851987 NA 1.37E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431851987 NA 7.18E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431851987 NA 1.96E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431851987 NA 3.09E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431851987 NA 3.67E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431851987 NA 7.24E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251