\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431840755:

Variant ID: vg0431840755 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31840755
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CGCAGGCGTTGGTGCCTCTTGTGTGGTTGTGAGGATGAAGGCAACTTGTGCTTAGTTTAAATATTTCATCTATCATTGCTTCCAATTTTCTAATTTATTT[T/C]
TATACAATTACAAAGTAATTAAATAGATATTTAAGCATATTTATCAGTTTGTAGGACTATGCTTTCCATTGCTGAATTACTTTCTTCAGTTGTTCTTTTG

Reverse complement sequence

CAAAAGAACAACTGAAGAAAGTAATTCAGCAATGGAAAGCATAGTCCTACAAACTGATAAATATGCTTAAATATCTATTTAATTACTTTGTAATTGTATA[A/G]
AAATAAATTAGAAAATTGGAAGCAATGATAGATGAAATATTTAAACTAAGCACAAGTTGCCTTCATCCTCACAACCACACAAGAGGCACCAACGCCTGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.02% 0.00% NA
All Indica  2759 89.50% 10.50% 0.04% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 80.40% 19.60% 0.00% 0.00% NA
Indica III  913 83.40% 16.50% 0.11% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431840755 T -> C LOC_Os04g53460.1 upstream_gene_variant ; 4274.0bp to feature; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N
vg0431840755 T -> C LOC_Os04g53460.2 upstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N
vg0431840755 T -> C LOC_Os04g53460.3 upstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N
vg0431840755 T -> C LOC_Os04g53460.4 upstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N
vg0431840755 T -> C LOC_Os04g53480.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N
vg0431840755 T -> C LOC_Os04g53470.1 intron_variant ; MODIFIER silent_mutation Average:62.711; most accessible tissue: Callus, score: 80.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431840755 NA 6.44E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755 NA 2.19E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755 NA 9.03E-10 mr1425_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755 NA 1.98E-06 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251