Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431840755:

Variant ID: vg0431840755 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31840755
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGCAGGCGTTGGTGCCTCTTGTGTGGTTGTGAGGATGAAGGCAACTTGTGCTTAGTTTAAATATTTCATCTATCATTGCTTCCAATTTTCTAATTTATTT[T/C]
TATACAATTACAAAGTAATTAAATAGATATTTAAGCATATTTATCAGTTTGTAGGACTATGCTTTCCATTGCTGAATTACTTTCTTCAGTTGTTCTTTTG

Reverse complement sequence

CAAAAGAACAACTGAAGAAAGTAATTCAGCAATGGAAAGCATAGTCCTACAAACTGATAAATATGCTTAAATATCTATTTAATTACTTTGTAATTGTATA[A/G]
AAATAAATTAGAAAATTGGAAGCAATGATAGATGAAATATTTAAACTAAGCACAAGTTGCCTTCATCCTCACAACCACACAAGAGGCACCAACGCCTGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.50%	0.02%	0.00%	NA
All Indica	2759	89.50%	10.50%	0.04%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	80.40%	19.60%	0.00%	0.00%	NA
Indica III	913	83.40%	16.50%	0.11%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431840755	T -> C	LOC_Os04g53460.1	upstream_gene_variant ; 4274.0bp to feature; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N
vg0431840755	T -> C	LOC_Os04g53460.2	upstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N
vg0431840755	T -> C	LOC_Os04g53460.3	upstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N
vg0431840755	T -> C	LOC_Os04g53460.4	upstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N
vg0431840755	T -> C	LOC_Os04g53480.1	downstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N
vg0431840755	T -> C	LOC_Os04g53470.1	intron_variant ; MODIFIER	silent_mutation	Average:62.711; most accessible tissue: Callus, score: 80.349	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431840755	NA	6.44E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755	NA	2.19E-06	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755	NA	9.03E-10	mr1425_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840755	NA	1.98E-06	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251