\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431840206:

Variant ID: vg0431840206 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31840206
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCGGTGGTCTGACCGGAAAAAATCGGAACCAGGGCCTTAGCCGGTCCACCTAAAAGATCGAGTGTGCAATTGAACCGGAATAAACAGGTTGAACTGC[T/C]
GGTTTTTACATTGAAACTGGTTGAATACAGGACAATAAACCGGCTAAATGGGCCGGTGCACGACGCTGACTCAGCTTGAATGGCACAAGATGGGTATGTG

Reverse complement sequence

CACATACCCATCTTGTGCCATTCAAGCTGAGTCAGCGTCGTGCACCGGCCCATTTAGCCGGTTTATTGTCCTGTATTCAACCAGTTTCAATGTAAAAACC[A/G]
GCAGTTCAACCTGTTTATTCCGGTTCAATTGCACACTCGATCTTTTAGGTGGACCGGCTAAGGCCCTGGTTCCGATTTTTTCCGGTCAGACCACCGATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.80% 0.21% 0.00% NA
All Indica  2759 58.80% 41.20% 0.04% 0.00% NA
All Japonica  1512 47.80% 52.10% 0.20% 0.00% NA
Aus  269 65.10% 34.60% 0.37% 0.00% NA
Indica I  595 60.80% 39.20% 0.00% 0.00% NA
Indica II  465 36.80% 63.20% 0.00% 0.00% NA
Indica III  913 73.90% 26.10% 0.00% 0.00% NA
Indica Intermediate  786 52.70% 47.20% 0.13% 0.00% NA
Temperate Japonica  767 17.60% 82.00% 0.39% 0.00% NA
Tropical Japonica  504 84.90% 15.10% 0.00% 0.00% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 54.40% 41.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431840206 T -> C LOC_Os04g53460.1 upstream_gene_variant ; 3725.0bp to feature; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N
vg0431840206 T -> C LOC_Os04g53460.2 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N
vg0431840206 T -> C LOC_Os04g53460.3 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N
vg0431840206 T -> C LOC_Os04g53460.4 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N
vg0431840206 T -> C LOC_Os04g53480.1 downstream_gene_variant ; 2954.0bp to feature; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N
vg0431840206 T -> C LOC_Os04g53470.1 intron_variant ; MODIFIER silent_mutation Average:77.082; most accessible tissue: Callus, score: 87.879 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431840206 NA 9.94E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431840206 NA 4.14E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431840206 NA 1.24E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431840206 NA 4.85E-06 mr1003 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 3.66E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 5.48E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 5.11E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 5.86E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 2.04E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 9.96E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 1.77E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 5.76E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 3.68E-07 5.16E-12 mr1229_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 3.63E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 2.86E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 7.61E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 5.27E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 3.45E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 6.97E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 6.11E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 5.75E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 3.22E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 7.01E-08 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 8.42E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 6.14E-06 2.76E-09 mr1763_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 7.75E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 3.40E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 2.53E-06 1.40E-11 mr1880_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431840206 NA 4.54E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251