\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431823585:

Variant ID: vg0431823585 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31823585
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTTGCGTGTTGGATTCTCCTTTTTCGTGAAGGACAAGTGAGTTTTCTGGTTGCCTGATTGGCCACGTGGGCGGACATTGCATCAGGGCATCAGTGT[A/G]
TGCTCTGCACAATGGAATCTCGCCAACTTTTGCTTCGACACTTTACCCCGGTTAAAATCTTTGCTCGTGTTTTTTTTCACCGTGAAAATGGCTGTTAAAA

Reverse complement sequence

TTTTAACAGCCATTTTCACGGTGAAAAAAAACACGAGCAAAGATTTTAACCGGGGTAAAGTGTCGAAGCAAAAGTTGGCGAGATTCCATTGTGCAGAGCA[T/C]
ACACTGATGCCCTGATGCAATGTCCGCCCACGTGGCCAATCAGGCAACCAGAAAACTCACTTGTCCTTCACGAAAAAGGAGAATCCAACACGCAAAAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 30.90% 0.08% 0.00% NA
All Indica  2759 79.60% 20.30% 0.11% 0.00% NA
All Japonica  1512 46.40% 53.60% 0.07% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 51.30% 48.40% 0.34% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 81.90% 17.90% 0.13% 0.00% NA
Temperate Japonica  767 21.80% 78.10% 0.13% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431823585 A -> G LOC_Os04g53450.1 upstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:85.931; most accessible tissue: Minghui63 panicle, score: 94.717 N N N N
vg0431823585 A -> G LOC_Os04g53430.1 downstream_gene_variant ; 4839.0bp to feature; MODIFIER silent_mutation Average:85.931; most accessible tissue: Minghui63 panicle, score: 94.717 N N N N
vg0431823585 A -> G LOC_Os04g53440.1 downstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:85.931; most accessible tissue: Minghui63 panicle, score: 94.717 N N N N
vg0431823585 A -> G LOC_Os04g53440.2 downstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:85.931; most accessible tissue: Minghui63 panicle, score: 94.717 N N N N
vg0431823585 A -> G LOC_Os04g53440-LOC_Os04g53450 intergenic_region ; MODIFIER silent_mutation Average:85.931; most accessible tissue: Minghui63 panicle, score: 94.717 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431823585 A G 0.04 0.08 0.1 0.04 0.1 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431823585 NA 2.06E-14 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431823585 NA 1.29E-21 Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431823585 NA 7.70E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431823585 NA 6.12E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431823585 NA 9.87E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431823585 NA 4.84E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431823585 NA 1.47E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431823585 NA 7.18E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431823585 NA 4.43E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251