\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431811408:

Variant ID: vg0431811408 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31811408
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTCGTTAGTGGCACAGGCTCTCTCAGCCCTGACCAAAAATGGGCTAATCTAGTTGGTCAGGCCTGTGGCGGGCATGTTCAGATTCTGCAGTTTTGGGCC[G/A]
GAATCACCAATTTCTCTCTCAGCCCTGACCAAAAATGGGCTAATCTAGTTGGGCCGCCTAGTCAGACGCATGAACGGCCACGTGGCACGTGCTTCGTCCG

Reverse complement sequence

CGGACGAAGCACGTGCCACGTGGCCGTTCATGCGTCTGACTAGGCGGCCCAACTAGATTAGCCCATTTTTGGTCAGGGCTGAGAGAGAAATTGGTGATTC[C/T]
GGCCCAAAACTGCAGAATCTGAACATGCCCGCCACAGGCCTGACCAACTAGATTAGCCCATTTTTGGTCAGGGCTGAGAGAGCCTGTGCCACTAACGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.60% 0.02% 0.00% NA
All Indica  2759 91.60% 8.40% 0.00% 0.00% NA
All Japonica  1512 59.10% 40.90% 0.07% 0.00% NA
Aus  269 65.80% 34.20% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 90.30% 9.70% 0.00% 0.00% NA
Indica Intermediate  786 90.70% 9.30% 0.00% 0.00% NA
Temperate Japonica  767 82.80% 17.10% 0.13% 0.00% NA
Tropical Japonica  504 33.30% 66.70% 0.00% 0.00% NA
Japonica Intermediate  241 37.30% 62.70% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431811408 G -> A LOC_Os04g53410.1 upstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:99.125; most accessible tissue: Minghui63 root, score: 99.635 N N N N
vg0431811408 G -> A LOC_Os04g53400.1 downstream_gene_variant ; 573.0bp to feature; MODIFIER silent_mutation Average:99.125; most accessible tissue: Minghui63 root, score: 99.635 N N N N
vg0431811408 G -> A LOC_Os04g53420.1 downstream_gene_variant ; 3564.0bp to feature; MODIFIER silent_mutation Average:99.125; most accessible tissue: Minghui63 root, score: 99.635 N N N N
vg0431811408 G -> A LOC_Os04g53400-LOC_Os04g53410 intergenic_region ; MODIFIER silent_mutation Average:99.125; most accessible tissue: Minghui63 root, score: 99.635 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431811408 G A -0.12 -0.18 -0.14 -0.1 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431811408 NA 4.02E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431811408 5.48E-06 5.48E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 4.91E-08 mr1590 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 3.82E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 6.51E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 7.31E-07 mr1790 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 7.24E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 9.19E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 6.71E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 2.84E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 1.60E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 5.45E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 1.56E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 1.06E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 5.02E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 5.24E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 3.85E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 8.42E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 1.92E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431811408 NA 6.96E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251