Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431785607:

Variant ID: vg0431785607 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31785607
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATCCGATACTTTGTTTTCGCATATTTATTATCTGACAGTGTCGGCGCTCCGGGTTATACAAGTTTACCATGTCGGAGAATTTAAGGGGAGAGCGGTT[C/T]
CATTCTTCTCTCTCATTCTCTCTTCCTCAATACTAAGGTGTGCTTGGTTTGTTACTATGCCAAAATATTGGTAACCAAAATCTAGGCAAGTTTTTGTAGT

Reverse complement sequence

ACTACAAAAACTTGCCTAGATTTTGGTTACCAATATTTTGGCATAGTAACAAACCAAGCACACCTTAGTATTGAGGAAGAGAGAATGAGAGAGAAGAATG[G/A]
AACCGCTCTCCCCTTAAATTCTCCGACATGGTAAACTTGTATAACCCGGAGCGCCGACACTGTCAGATAATAAATATGCGAAAACAAAGTATCGGATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 7.20% 0.28% 4.99% NA
All Indica  2759 80.50% 11.80% 0.40% 7.32% NA
All Japonica  1512 97.60% 0.50% 0.13% 1.79% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 91.10% 6.20% 1.01% 1.68% NA
Indica II  465 79.80% 17.00% 0.00% 3.23% NA
Indica III  913 72.40% 15.10% 0.11% 12.38% NA
Indica Intermediate  786 82.30% 9.00% 0.51% 8.14% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 0.40% 0.20% 5.16% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 88.90% 6.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431785607 C -> DEL N N silent_mutation Average:78.882; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N
vg0431785607 C -> T LOC_Os04g53370.1 upstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:78.882; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N
vg0431785607 C -> T LOC_Os04g53360.1 downstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:78.882; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N
vg0431785607 C -> T LOC_Os04g53380.1 downstream_gene_variant ; 2802.0bp to feature; MODIFIER silent_mutation Average:78.882; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N
vg0431785607 C -> T LOC_Os04g53360-LOC_Os04g53370 intergenic_region ; MODIFIER silent_mutation Average:78.882; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431785607 C T 0.01 -0.02 -0.02 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431785607 NA 5.44E-06 mr1252 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 2.92E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 5.75E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 1.06E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 1.46E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 8.56E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 6.04E-08 mr1252_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 2.36E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 5.94E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.84E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 4.16E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 1.91E-06 1.91E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 4.58E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.70E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.75E-09 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 2.94E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 9.54E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.34E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 8.78E-06 8.78E-06 mr1596_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 6.42E-07 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 4.80E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 7.38E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.66E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 5.31E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 6.10E-06 mr1785_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 2.94E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 1.92E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 4.07E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 3.83E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 6.71E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 6.07E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431785607 NA 5.97E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251