Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431782557:

Variant ID: vg0431782557 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31782557
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AATAGTAAACTACTTCAATAGTATGTCTACATGGGTATCTATAGCTCTCTAATGCATTGCCTCGTTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAG[C/T]
TGTGCTCTCTCTCTTCATTTAATCTCTTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCCTATATATAACCATTGTGGGTGCCTTAACA

Reverse complement sequence

TGTTAAGGCACCCACAATGGTTATATATAGGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAAGAGATTAAATGAAGAGAGAGAGCACA[G/A]
CTATCTACTAACCTGGAGATAGTCTATAGAGAAAAACGAGGCAATGCATTAGAGAGCTATAGATACCCATGTAGACATACTATTGAAGTAGTTTACTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	22.80%	0.17%	5.42%	NA
All Indica	2759	73.00%	19.00%	0.29%	7.72%	NA
All Japonica	1512	75.40%	22.80%	0.00%	1.85%	NA
Aus	269	52.00%	44.60%	0.00%	3.35%	NA
Indica I	595	86.40%	11.40%	0.17%	2.02%	NA
Indica II	465	79.60%	17.00%	0.22%	3.23%	NA
Indica III	913	62.90%	23.40%	0.55%	13.14%	NA
Indica Intermediate	786	70.60%	20.90%	0.13%	8.40%	NA
Temperate Japonica	767	89.00%	11.00%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	26.40%	0.00%	5.16%	NA
Japonica Intermediate	241	46.50%	52.70%	0.00%	0.83%	NA
VI/Aromatic	96	35.40%	63.50%	0.00%	1.04%	NA
Intermediate	90	64.40%	30.00%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431782557	C -> DEL	N	N	silent_mutation	Average:51.213; most accessible tissue: Callus, score: 84.832	N	N	N	N
vg0431782557	C -> T	LOC_Os04g53370.1	upstream_gene_variant ; 4032.0bp to feature; MODIFIER	silent_mutation	Average:51.213; most accessible tissue: Callus, score: 84.832	N	N	N	N
vg0431782557	C -> T	LOC_Os04g53360.1	downstream_gene_variant ; 1559.0bp to feature; MODIFIER	silent_mutation	Average:51.213; most accessible tissue: Callus, score: 84.832	N	N	N	N
vg0431782557	C -> T	LOC_Os04g53360-LOC_Os04g53370	intergenic_region ; MODIFIER	silent_mutation	Average:51.213; most accessible tissue: Callus, score: 84.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431782557	NA	3.68E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431782557	NA	7.45E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557	NA	9.48E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557	NA	1.56E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557	3.79E-06	5.16E-07	mr1115_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557	NA	6.31E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557	NA	1.08E-06	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251