\
| Variant ID: vg0431782557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31782557 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 92. )
AATAGTAAACTACTTCAATAGTATGTCTACATGGGTATCTATAGCTCTCTAATGCATTGCCTCGTTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAG[C/T]
TGTGCTCTCTCTCTTCATTTAATCTCTTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCCTATATATAACCATTGTGGGTGCCTTAACA
TGTTAAGGCACCCACAATGGTTATATATAGGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAAGAGATTAAATGAAGAGAGAGAGCACA[G/A]
CTATCTACTAACCTGGAGATAGTCTATAGAGAAAAACGAGGCAATGCATTAGAGAGCTATAGATACCCATGTAGACATACTATTGAAGTAGTTTACTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 22.80% | 0.17% | 5.42% | NA |
| All Indica | 2759 | 73.00% | 19.00% | 0.29% | 7.72% | NA |
| All Japonica | 1512 | 75.40% | 22.80% | 0.00% | 1.85% | NA |
| Aus | 269 | 52.00% | 44.60% | 0.00% | 3.35% | NA |
| Indica I | 595 | 86.40% | 11.40% | 0.17% | 2.02% | NA |
| Indica II | 465 | 79.60% | 17.00% | 0.22% | 3.23% | NA |
| Indica III | 913 | 62.90% | 23.40% | 0.55% | 13.14% | NA |
| Indica Intermediate | 786 | 70.60% | 20.90% | 0.13% | 8.40% | NA |
| Temperate Japonica | 767 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.50% | 26.40% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 46.50% | 52.70% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 35.40% | 63.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 30.00% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431782557 | C -> DEL | N | N | silent_mutation | Average:51.213; most accessible tissue: Callus, score: 84.832 | N | N | N | N |
| vg0431782557 | C -> T | LOC_Os04g53370.1 | upstream_gene_variant ; 4032.0bp to feature; MODIFIER | silent_mutation | Average:51.213; most accessible tissue: Callus, score: 84.832 | N | N | N | N |
| vg0431782557 | C -> T | LOC_Os04g53360.1 | downstream_gene_variant ; 1559.0bp to feature; MODIFIER | silent_mutation | Average:51.213; most accessible tissue: Callus, score: 84.832 | N | N | N | N |
| vg0431782557 | C -> T | LOC_Os04g53360-LOC_Os04g53370 | intergenic_region ; MODIFIER | silent_mutation | Average:51.213; most accessible tissue: Callus, score: 84.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431782557 | NA | 3.68E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431782557 | NA | 7.45E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431782557 | NA | 9.48E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431782557 | NA | 1.56E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431782557 | 3.79E-06 | 5.16E-07 | mr1115_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431782557 | NA | 6.31E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431782557 | NA | 1.08E-06 | mr1788_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |