\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431782557:

Variant ID: vg0431782557 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31782557
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGTAAACTACTTCAATAGTATGTCTACATGGGTATCTATAGCTCTCTAATGCATTGCCTCGTTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAG[C/T]
TGTGCTCTCTCTCTTCATTTAATCTCTTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCCTATATATAACCATTGTGGGTGCCTTAACA

Reverse complement sequence

TGTTAAGGCACCCACAATGGTTATATATAGGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAAGAGATTAAATGAAGAGAGAGAGCACA[G/A]
CTATCTACTAACCTGGAGATAGTCTATAGAGAAAAACGAGGCAATGCATTAGAGAGCTATAGATACCCATGTAGACATACTATTGAAGTAGTTTACTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 22.80% 0.17% 5.42% NA
All Indica  2759 73.00% 19.00% 0.29% 7.72% NA
All Japonica  1512 75.40% 22.80% 0.00% 1.85% NA
Aus  269 52.00% 44.60% 0.00% 3.35% NA
Indica I  595 86.40% 11.40% 0.17% 2.02% NA
Indica II  465 79.60% 17.00% 0.22% 3.23% NA
Indica III  913 62.90% 23.40% 0.55% 13.14% NA
Indica Intermediate  786 70.60% 20.90% 0.13% 8.40% NA
Temperate Japonica  767 89.00% 11.00% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 26.40% 0.00% 5.16% NA
Japonica Intermediate  241 46.50% 52.70% 0.00% 0.83% NA
VI/Aromatic  96 35.40% 63.50% 0.00% 1.04% NA
Intermediate  90 64.40% 30.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431782557 C -> DEL N N silent_mutation Average:51.213; most accessible tissue: Callus, score: 84.832 N N N N
vg0431782557 C -> T LOC_Os04g53370.1 upstream_gene_variant ; 4032.0bp to feature; MODIFIER silent_mutation Average:51.213; most accessible tissue: Callus, score: 84.832 N N N N
vg0431782557 C -> T LOC_Os04g53360.1 downstream_gene_variant ; 1559.0bp to feature; MODIFIER silent_mutation Average:51.213; most accessible tissue: Callus, score: 84.832 N N N N
vg0431782557 C -> T LOC_Os04g53360-LOC_Os04g53370 intergenic_region ; MODIFIER silent_mutation Average:51.213; most accessible tissue: Callus, score: 84.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431782557 NA 3.68E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431782557 NA 7.45E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557 NA 9.48E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557 NA 1.56E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557 3.79E-06 5.16E-07 mr1115_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557 NA 6.31E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431782557 NA 1.08E-06 mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251