\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431775632:

Variant ID: vg0431775632 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 31775632
Reference Allele: AGTAGGAlternative Allele: GGTAGG,ATAGG,A
Primary Allele: GGTAGGSecondary Allele: AGTAGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATATTATATTGGTTTATTTTGAAACGGAGAGATTAGTATAGAGCCTGTTCACTTTGATGTAAAAAAAAACCTTTTTTGGTAAAGTTGTCAAAATTTC[AGTAGG/GGTAGG,ATAGG,A]
ATTTCTTATATAGTTACCAAAATTTAATAGCAAACTAAATGTAGCTATTTTTTTTATAACTTAACTAAAATTTGGTTAGATTGAAAATGTGAACATGCCC

Reverse complement sequence

GGGCATGTTCACATTTTCAATCTAACCAAATTTTAGTTAAGTTATAAAAAAAATAGCTACATTTAGTTTGCTATTAAATTTTGGTAACTATATAAGAAAT[CCTACT/CCTACC,CCTAT,T]
GAAATTTTGACAACTTTACCAAAAAAGGTTTTTTTTTACATCAAAGTGAACAGGCTCTATACTAATCTCTCCGTTTCAAAATAAACCAATATAATATTAG

Allele Frequencies:

Populations Population SizeFrequency of GGTAGG(primary allele) Frequency of AGTAGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 31.60% 1.10% 0.00% ATAGG: 2.81%; A: 0.28%
All Indica  2759 75.90% 17.90% 1.16% 0.00% ATAGG: 4.53%; A: 0.47%
All Japonica  1512 39.80% 59.30% 0.86% 0.00% ATAGG: 0.07%
Aus  269 74.00% 24.20% 1.86% 0.00% NA
Indica I  595 78.00% 18.20% 1.68% 0.00% A: 1.18%; ATAGG: 1.01%
Indica II  465 79.10% 16.30% 0.43% 0.00% ATAGG: 4.09%
Indica III  913 68.30% 22.90% 0.88% 0.00% ATAGG: 7.89%
Indica Intermediate  786 81.20% 13.00% 1.53% 0.00% ATAGG: 3.56%; A: 0.76%
Temperate Japonica  767 12.90% 85.70% 1.43% 0.00% NA
Tropical Japonica  504 70.20% 29.60% 0.00% 0.00% ATAGG: 0.20%
Japonica Intermediate  241 61.80% 37.30% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 52.20% 37.80% 2.22% 0.00% ATAGG: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431775632 AGTAGG -> A LOC_Os04g53350.1 upstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> A LOC_Os04g53360.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> A LOC_Os04g53350-LOC_Os04g53360 intergenic_region ; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> GGTAGG LOC_Os04g53350.1 upstream_gene_variant ; 2459.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> GGTAGG LOC_Os04g53360.1 upstream_gene_variant ; 1586.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> GGTAGG LOC_Os04g53350-LOC_Os04g53360 intergenic_region ; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> ATAGG LOC_Os04g53350.1 upstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> ATAGG LOC_Os04g53360.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N
vg0431775632 AGTAGG -> ATAGG LOC_Os04g53350-LOC_Os04g53360 intergenic_region ; MODIFIER silent_mutation Average:86.635; most accessible tissue: Minghui63 flower, score: 93.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431775632 AGTAG* A -0.03 -0.02 -0.07 -0.16 -0.19 -0.19
vg0431775632 AGTAG* ATAGG -0.17 -0.06 -0.1 -0.09 -0.13 -0.14
vg0431775632 AGTAG* GGTAG* 0.02 0.01 0.0 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431775632 NA 3.74E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431775632 NA 9.34E-06 mr1717_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251