\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431750090:

Variant ID: vg0431750090 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31750090
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAAAAACAACAAATTTGACCGTGATTTACGCAGTTAAATTTGTTATTTTTGTTTCTACTTGTATAAGTTGAATTTGAATTTGTATGTTTGTGAAATAA[C/A]
ATATTATATATTGATGTAATATTGATCTATACTGCTATATTTTTTTAATTTTTTTGATGACTTTTTACTTGACATGTAAAAATGAGAGGATTATTTGAGT

Reverse complement sequence

ACTCAAATAATCCTCTCATTTTTACATGTCAAGTAAAAAGTCATCAAAAAAATTAAAAAAATATAGCAGTATAGATCAATATTACATCAATATATAATAT[G/T]
TTATTTCACAAACATACAAATTCAAATTCAACTTATACAAGTAGAAACAAAAATAACAAATTTAACTGCGTAAATCACGGTCAAATTTGTTGTTTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.90% 0.02% 0.00% NA
All Indica  2759 89.10% 10.90% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 88.00% 12.00% 0.00% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 89.20% 10.70% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431750090 C -> A LOC_Os04g53310.1 downstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:54.823; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0431750090 C -> A LOC_Os04g53300.1 intron_variant ; MODIFIER silent_mutation Average:54.823; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431750090 NA 2.73E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 1.40E-06 1.40E-06 mr1314_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 NA 7.29E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 3.21E-06 3.20E-06 mr1487_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 NA 9.20E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 NA 5.77E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 NA 8.13E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 NA 2.46E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431750090 4.19E-06 4.19E-06 mr1967_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251