\
| Variant ID: vg0431750090 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31750090 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACAAAAACAACAAATTTGACCGTGATTTACGCAGTTAAATTTGTTATTTTTGTTTCTACTTGTATAAGTTGAATTTGAATTTGTATGTTTGTGAAATAA[C/A]
ATATTATATATTGATGTAATATTGATCTATACTGCTATATTTTTTTAATTTTTTTGATGACTTTTTACTTGACATGTAAAAATGAGAGGATTATTTGAGT
ACTCAAATAATCCTCTCATTTTTACATGTCAAGTAAAAAGTCATCAAAAAAATTAAAAAAATATAGCAGTATAGATCAATATTACATCAATATATAATAT[G/T]
TTATTTCACAAACATACAAATTCAAATTCAACTTATACAAGTAGAAACAAAAATAACAAATTTAACTGCGTAAATCACGGTCAAATTTGTTGTTTTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 10.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 10.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431750090 | C -> A | LOC_Os04g53310.1 | downstream_gene_variant ; 865.0bp to feature; MODIFIER | silent_mutation | Average:54.823; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0431750090 | C -> A | LOC_Os04g53300.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.823; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431750090 | NA | 2.73E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | 1.40E-06 | 1.40E-06 | mr1314_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | NA | 7.29E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | 3.21E-06 | 3.20E-06 | mr1487_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | NA | 9.20E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | NA | 5.77E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | NA | 8.13E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | NA | 2.46E-06 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431750090 | 4.19E-06 | 4.19E-06 | mr1967_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |