\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431710090:

Variant ID: vg0431710090 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 31710090
Reference Allele: CAlternative Allele: T,CAATTTTAAGCAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGATTTTTTCTCGCACTACCATTCGTCTTATTTAAAAAAAATAAAGTTATTATTTATTTTATTTGTGACTTACTTTATCATCCAGAGTACTTTAAGCA[C/T,CAATTTTAAGCAT]
AATTTTTCGTTTTTTATATTTGCATAAATTTTTTAAATAAGACGAGTGGTCAAACGATACAAACAGAAAGTCGAATTCCCTTATATTATAGTACGGAGGG

Reverse complement sequence

CCCTCCGTACTATAATATAAGGGAATTCGACTTTCTGTTTGTATCGTTTGACCACTCGTCTTATTTAAAAAATTTATGCAAATATAAAAAACGAAAAATT[G/A,ATGCTTAAAATTG]
TGCTTAAAGTACTCTGGATGATAAAGTAAGTCACAAATAAAATAAATAATAACTTTATTTTTTTTAAATAAGACGAATGGTAGTGCGAGAAAAAATCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 10.50% 0.21% 7.32% CAATTTTAAGCAT: 0.38%
All Indica  2759 68.90% 17.70% 0.36% 12.43% CAATTTTAAGCAT: 0.65%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 54.10% 8.20% 0.84% 36.81% NA
Indica II  465 77.20% 19.40% 0.00% 3.44% NA
Indica III  913 66.50% 27.80% 0.11% 3.94% CAATTTTAAGCAT: 1.64%
Indica Intermediate  786 77.90% 12.10% 0.51% 9.16% CAATTTTAAGCAT: 0.38%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 5.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431710090 C -> DEL N N silent_mutation Average:64.058; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N
vg0431710090 C -> CAATTTTAAGCAT LOC_Os04g53230-LOC_Os04g53240 intergenic_region ; MODIFIER silent_mutation Average:64.058; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N
vg0431710090 C -> T LOC_Os04g53230-LOC_Os04g53240 intergenic_region ; MODIFIER silent_mutation Average:64.058; most accessible tissue: Minghui63 panicle, score: 96.113 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431710090 C CAATT* -0.11 -0.03 0.01 -0.14 -0.08 -0.09
vg0431710090 C T 0.0 -0.01 -0.01 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431710090 NA 2.10E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 5.35E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 5.35E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 2.36E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 5.73E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 2.36E-06 mr1956 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 3.92E-08 mr1956 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 7.90E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 6.10E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 3.13E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 2.96E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 3.09E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 3.01E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431710090 NA 2.48E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251