\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431700870:

Variant ID: vg0431700870 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31700870
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCATCAAAAAATAACCCAAAGAAATCAAAACAAAAGCGAGCACCCACCGATGATCACTCACTGATCTCTCATCACCAAACGCCTCCGACCTCGCTCGCG[T/C]
CGCGCGCCGCGCACCCATCCCCCCGGCCTCGCCACCACCCACTCCCGATCGCCCCCGTCGCCACCCACCCCCTCAGAAATCTCATCTTTTCCGCCTCCTC

Reverse complement sequence

GAGGAGGCGGAAAAGATGAGATTTCTGAGGGGGTGGGTGGCGACGGGGGCGATCGGGAGTGGGTGGTGGCGAGGCCGGGGGGATGGGTGCGCGGCGCGCG[A/G]
CGCGAGCGAGGTCGGAGGCGTTTGGTGATGAGAGATCAGTGAGTGATCATCGGTGGGTGCTCGCTTTTGTTTTGATTTCTTTGGGTTATTTTTTGATGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 29.50% 3.47% 4.10% NA
All Indica  2759 57.60% 29.70% 5.80% 6.96% NA
All Japonica  1512 74.20% 25.70% 0.07% 0.00% NA
Aus  269 60.60% 39.40% 0.00% 0.00% NA
Indica I  595 36.30% 26.60% 17.31% 19.83% NA
Indica II  465 74.60% 22.60% 1.08% 1.72% NA
Indica III  913 63.40% 32.40% 1.64% 2.52% NA
Indica Intermediate  786 56.70% 33.10% 4.71% 5.47% NA
Temperate Japonica  767 90.00% 9.90% 0.13% 0.00% NA
Tropical Japonica  504 63.30% 36.70% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 53.10% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 61.50% 1.04% 0.00% NA
Intermediate  90 70.00% 25.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431700870 T -> C LOC_Os04g53230.1 upstream_gene_variant ; 37.0bp to feature; MODIFIER silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N
vg0431700870 T -> C LOC_Os04g53214.2 downstream_gene_variant ; 4223.0bp to feature; MODIFIER silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N
vg0431700870 T -> C LOC_Os04g53220.1 downstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N
vg0431700870 T -> C LOC_Os04g53214.1 downstream_gene_variant ; 4225.0bp to feature; MODIFIER silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N
vg0431700870 T -> C LOC_Os04g53220-LOC_Os04g53230 intergenic_region ; MODIFIER silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N
vg0431700870 T -> DEL N N silent_mutation Average:95.578; most accessible tissue: Minghui63 flag leaf, score: 99.02 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431700870 T C -0.06 -0.05 -0.03 -0.01 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431700870 NA 2.24E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431700870 NA 1.35E-07 mr1249 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431700870 NA 9.69E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251