\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431675811:

Variant ID: vg0431675811 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31675811
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTTCTCCGTTCTCACAAACCATGCATTAGCACCGTTTCACAGAGAAGAGATCCCCTTCCGAAAAAAACAAACTTTAGTTTATCTGATATTTCAAAAAG[T/G]
TATATAATACGTAGTACTAACTGGCATGTATATCTTGAAACCCGTCGATCCAAAAAGAATTCTCAAATCGTAGGAAGAACATATTCACTGGAAAGGTTGA

Reverse complement sequence

TCAACCTTTCCAGTGAATATGTTCTTCCTACGATTTGAGAATTCTTTTTGGATCGACGGGTTTCAAGATATACATGCCAGTTAGTACTACGTATTATATA[A/C]
CTTTTTGAAATATCAGATAAACTAAAGTTTGTTTTTTTCGGAAGGGGATCTCTTCTCTGTGAAACGGTGCTAATGCATGGTTTGTGAGAACGGAGAAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.10% 0.06% 0.00% NA
All Indica  2759 87.10% 12.90% 0.07% 0.00% NA
All Japonica  1512 80.20% 19.80% 0.07% 0.00% NA
Aus  269 66.20% 33.80% 0.00% 0.00% NA
Indica I  595 88.90% 10.90% 0.17% 0.00% NA
Indica II  465 68.20% 31.80% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 85.40% 14.50% 0.13% 0.00% NA
Temperate Japonica  767 82.80% 17.10% 0.13% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 53.50% 46.50% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431675811 T -> G LOC_Os04g53190.1 upstream_gene_variant ; 1213.0bp to feature; MODIFIER silent_mutation Average:90.375; most accessible tissue: Minghui63 flower, score: 96.725 N N N N
vg0431675811 T -> G LOC_Os04g53195.1 upstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:90.375; most accessible tissue: Minghui63 flower, score: 96.725 N N N N
vg0431675811 T -> G LOC_Os04g53190.2 upstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:90.375; most accessible tissue: Minghui63 flower, score: 96.725 N N N N
vg0431675811 T -> G LOC_Os04g53200.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:90.375; most accessible tissue: Minghui63 flower, score: 96.725 N N N N
vg0431675811 T -> G LOC_Os04g53190-LOC_Os04g53200 intergenic_region ; MODIFIER silent_mutation Average:90.375; most accessible tissue: Minghui63 flower, score: 96.725 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431675811 T G -0.03 0.0 0.0 -0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431675811 NA 1.40E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 NA 7.46E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 NA 9.97E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 1.40E-07 1.40E-07 mr1197_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 5.78E-06 5.78E-06 mr1197_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 NA 3.96E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 NA 5.97E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431675811 NA 1.94E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251