\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431647737:

Variant ID: vg0431647737 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31647737
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGTCCATATAGAAATACAATTAGGAAATAACAAAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTA[A/G]
GAAATAACCGAAATTCGGAATTAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGAAAAAAAATAGAAATTTGAAATT

Reverse complement sequence

AATTTCAAATTTCTATTTTTTTTCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTAATTCCGAATTTCGGTTATTTC[T/C]
TAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTTTGTTATTTCCTAATTGTATTTCTATATGGACTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 21.80% 6.54% 34.41% NA
All Indica  2759 45.00% 5.80% 9.06% 40.16% NA
All Japonica  1512 19.00% 54.00% 3.31% 23.74% NA
Aus  269 50.60% 8.20% 1.86% 39.41% NA
Indica I  595 53.80% 13.40% 7.56% 25.21% NA
Indica II  465 66.00% 4.90% 9.46% 19.57% NA
Indica III  913 28.60% 0.70% 11.50% 59.26% NA
Indica Intermediate  786 45.00% 6.40% 7.12% 41.48% NA
Temperate Japonica  767 11.10% 80.60% 5.61% 2.74% NA
Tropical Japonica  504 13.50% 26.60% 0.99% 58.93% NA
Japonica Intermediate  241 55.60% 26.60% 0.83% 17.01% NA
VI/Aromatic  96 64.60% 4.20% 1.04% 30.21% NA
Intermediate  90 37.80% 32.20% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431647737 A -> DEL N N silent_mutation Average:36.535; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0431647737 A -> G LOC_Os04g53140.1 upstream_gene_variant ; 2784.0bp to feature; MODIFIER silent_mutation Average:36.535; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0431647737 A -> G LOC_Os04g53120.1 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:36.535; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0431647737 A -> G LOC_Os04g53130.1 intron_variant ; MODIFIER silent_mutation Average:36.535; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431647737 NA 1.56E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431647737 NA 1.13E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 5.32E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 2.97E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.51E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 3.87E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.24E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 7.80E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 5.03E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 4.08E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 8.53E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.48E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 8.68E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 9.99E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.39E-10 mr1164_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 8.90E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 9.65E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.27E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 6.66E-10 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.62E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.13E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 3.99E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 5.52E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 6.97E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 5.37E-12 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 1.74E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 4.03E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 3.41E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647737 NA 3.67E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251