\
| Variant ID: vg0431615803 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 31615803 |
| Reference Allele: C | Alternative Allele: A,T,CT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAAGCCTACTCCCTCCCTTAAAAAAACAAACCCTGGATATGAATTTGGACGTACAACTGGACATGATGCATGTACAAATTTATGCTCAGGGTTTGTCTT[C/A,T,CT]
TTTTTTTGAGACGGAGGGAGTACTCTATTTGCTTGAACACTCCTGCCTCCCTCCAAGATCAAAACTTCGGGTGTGTTTGGTTGTCGGCCACATTTTGCCA
TGGCAAAATGTGGCCGACAACCAAACACACCCGAAGTTTTGATCTTGGAGGGAGGCAGGAGTGTTCAAGCAAATAGAGTACTCCCTCCGTCTCAAAAAAA[G/T,A,AG]
AAGACAAACCCTGAGCATAAATTTGTACATGCATCATGTCCAGTTGTACGTCCAAATTCATATCCAGGGTTTGTTTTTTTAAGGGAGGGAGTAGGCTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 15.60% | 13.46% | 34.15% | CT: 4.38%; A: 1.63% |
| All Indica | 2759 | 18.50% | 16.90% | 16.93% | 39.00% | CT: 6.02%; A: 2.68% |
| All Japonica | 1512 | 58.30% | 8.30% | 8.00% | 24.67% | CT: 0.73%; A: 0.07% |
| Aus | 269 | 9.30% | 36.10% | 8.92% | 37.55% | CT: 8.18% |
| Indica I | 595 | 22.20% | 4.90% | 19.33% | 50.08% | CT: 2.69%; A: 0.84% |
| Indica II | 465 | 38.70% | 21.50% | 9.46% | 25.38% | CT: 3.66%; A: 1.29% |
| Indica III | 913 | 2.70% | 25.20% | 17.96% | 42.83% | CT: 9.53%; A: 1.75% |
| Indica Intermediate | 786 | 22.10% | 13.50% | 18.32% | 34.22% | A: 5.98%; CT: 5.85% |
| Temperate Japonica | 767 | 85.90% | 4.30% | 1.30% | 7.69% | CT: 0.65%; A: 0.13% |
| Tropical Japonica | 504 | 26.40% | 9.50% | 17.26% | 46.43% | CT: 0.40% |
| Japonica Intermediate | 241 | 36.90% | 18.30% | 9.96% | 33.20% | CT: 1.66% |
| VI/Aromatic | 96 | 5.20% | 43.80% | 13.54% | 37.50% | NA |
| Intermediate | 90 | 36.70% | 8.90% | 12.22% | 31.11% | CT: 8.89%; A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431615803 | C -> CT | LOC_Os04g53070.1 | upstream_gene_variant ; 4970.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> CT | LOC_Os04g53080.1 | downstream_gene_variant ; 2110.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> CT | LOC_Os04g53080-LOC_Os04g53110 | intergenic_region ; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> DEL | N | N | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> A | LOC_Os04g53070.1 | upstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> A | LOC_Os04g53080.1 | downstream_gene_variant ; 2109.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> A | LOC_Os04g53080-LOC_Os04g53110 | intergenic_region ; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> T | LOC_Os04g53070.1 | upstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> T | LOC_Os04g53080.1 | downstream_gene_variant ; 2109.0bp to feature; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| vg0431615803 | C -> T | LOC_Os04g53080-LOC_Os04g53110 | intergenic_region ; MODIFIER | silent_mutation | Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431615803 | NA | 7.85E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 6.09E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 5.55E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 4.66E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | 6.86E-06 | 1.23E-07 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 4.10E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 5.60E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 9.19E-07 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 4.61E-08 | mr1668_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 6.98E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431615803 | NA | 2.18E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |