Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431615803:

Variant ID: vg0431615803 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 31615803
Reference Allele: C	Alternative Allele: A,T,CT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAGCCTACTCCCTCCCTTAAAAAAACAAACCCTGGATATGAATTTGGACGTACAACTGGACATGATGCATGTACAAATTTATGCTCAGGGTTTGTCTT[C/A,T,CT]
TTTTTTTGAGACGGAGGGAGTACTCTATTTGCTTGAACACTCCTGCCTCCCTCCAAGATCAAAACTTCGGGTGTGTTTGGTTGTCGGCCACATTTTGCCA

Reverse complement sequence

TGGCAAAATGTGGCCGACAACCAAACACACCCGAAGTTTTGATCTTGGAGGGAGGCAGGAGTGTTCAAGCAAATAGAGTACTCCCTCCGTCTCAAAAAAA[G/T,A,AG]
AAGACAAACCCTGAGCATAAATTTGTACATGCATCATGTCCAGTTGTACGTCCAAATTCATATCCAGGGTTTGTTTTTTTAAGGGAGGGAGTAGGCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.80%	15.60%	13.46%	34.15%	CT: 4.38%; A: 1.63%
All Indica	2759	18.50%	16.90%	16.93%	39.00%	CT: 6.02%; A: 2.68%
All Japonica	1512	58.30%	8.30%	8.00%	24.67%	CT: 0.73%; A: 0.07%
Aus	269	9.30%	36.10%	8.92%	37.55%	CT: 8.18%
Indica I	595	22.20%	4.90%	19.33%	50.08%	CT: 2.69%; A: 0.84%
Indica II	465	38.70%	21.50%	9.46%	25.38%	CT: 3.66%; A: 1.29%
Indica III	913	2.70%	25.20%	17.96%	42.83%	CT: 9.53%; A: 1.75%
Indica Intermediate	786	22.10%	13.50%	18.32%	34.22%	A: 5.98%; CT: 5.85%
Temperate Japonica	767	85.90%	4.30%	1.30%	7.69%	CT: 0.65%; A: 0.13%
Tropical Japonica	504	26.40%	9.50%	17.26%	46.43%	CT: 0.40%
Japonica Intermediate	241	36.90%	18.30%	9.96%	33.20%	CT: 1.66%
VI/Aromatic	96	5.20%	43.80%	13.54%	37.50%	NA
Intermediate	90	36.70%	8.90%	12.22%	31.11%	CT: 8.89%; A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431615803	C -> CT	LOC_Os04g53070.1	upstream_gene_variant ; 4970.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> CT	LOC_Os04g53080.1	downstream_gene_variant ; 2110.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> CT	LOC_Os04g53080-LOC_Os04g53110	intergenic_region ; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> DEL	N	N	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> A	LOC_Os04g53070.1	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> A	LOC_Os04g53080.1	downstream_gene_variant ; 2109.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> A	LOC_Os04g53080-LOC_Os04g53110	intergenic_region ; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> T	LOC_Os04g53070.1	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> T	LOC_Os04g53080.1	downstream_gene_variant ; 2109.0bp to feature; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0431615803	C -> T	LOC_Os04g53080-LOC_Os04g53110	intergenic_region ; MODIFIER	silent_mutation	Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431615803	NA	7.85E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	6.09E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	5.55E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	4.66E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	6.86E-06	1.23E-07	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	4.10E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	5.60E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	9.19E-07	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	4.61E-08	mr1668_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	6.98E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803	NA	2.18E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251