\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431615803:

Variant ID: vg0431615803 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 31615803
Reference Allele: CAlternative Allele: A,T,CT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAGCCTACTCCCTCCCTTAAAAAAACAAACCCTGGATATGAATTTGGACGTACAACTGGACATGATGCATGTACAAATTTATGCTCAGGGTTTGTCTT[C/A,T,CT]
TTTTTTTGAGACGGAGGGAGTACTCTATTTGCTTGAACACTCCTGCCTCCCTCCAAGATCAAAACTTCGGGTGTGTTTGGTTGTCGGCCACATTTTGCCA

Reverse complement sequence

TGGCAAAATGTGGCCGACAACCAAACACACCCGAAGTTTTGATCTTGGAGGGAGGCAGGAGTGTTCAAGCAAATAGAGTACTCCCTCCGTCTCAAAAAAA[G/T,A,AG]
AAGACAAACCCTGAGCATAAATTTGTACATGCATCATGTCCAGTTGTACGTCCAAATTCATATCCAGGGTTTGTTTTTTTAAGGGAGGGAGTAGGCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.80% 15.60% 13.46% 34.15% CT: 4.38%; A: 1.63%
All Indica  2759 18.50% 16.90% 16.93% 39.00% CT: 6.02%; A: 2.68%
All Japonica  1512 58.30% 8.30% 8.00% 24.67% CT: 0.73%; A: 0.07%
Aus  269 9.30% 36.10% 8.92% 37.55% CT: 8.18%
Indica I  595 22.20% 4.90% 19.33% 50.08% CT: 2.69%; A: 0.84%
Indica II  465 38.70% 21.50% 9.46% 25.38% CT: 3.66%; A: 1.29%
Indica III  913 2.70% 25.20% 17.96% 42.83% CT: 9.53%; A: 1.75%
Indica Intermediate  786 22.10% 13.50% 18.32% 34.22% A: 5.98%; CT: 5.85%
Temperate Japonica  767 85.90% 4.30% 1.30% 7.69% CT: 0.65%; A: 0.13%
Tropical Japonica  504 26.40% 9.50% 17.26% 46.43% CT: 0.40%
Japonica Intermediate  241 36.90% 18.30% 9.96% 33.20% CT: 1.66%
VI/Aromatic  96 5.20% 43.80% 13.54% 37.50% NA
Intermediate  90 36.70% 8.90% 12.22% 31.11% CT: 8.89%; A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431615803 C -> CT LOC_Os04g53070.1 upstream_gene_variant ; 4970.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> CT LOC_Os04g53080.1 downstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> CT LOC_Os04g53080-LOC_Os04g53110 intergenic_region ; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> DEL N N silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> A LOC_Os04g53070.1 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> A LOC_Os04g53080.1 downstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> A LOC_Os04g53080-LOC_Os04g53110 intergenic_region ; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> T LOC_Os04g53070.1 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> T LOC_Os04g53080.1 downstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N
vg0431615803 C -> T LOC_Os04g53080-LOC_Os04g53110 intergenic_region ; MODIFIER silent_mutation Average:83.164; most accessible tissue: Zhenshan97 flower, score: 93.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431615803 NA 7.85E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 6.09E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 5.55E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 4.66E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 6.86E-06 1.23E-07 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 4.10E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 5.60E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 9.19E-07 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 4.61E-08 mr1668_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 6.98E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431615803 NA 2.18E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251