Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431613586:

Variant ID: vg0431613586 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31613586
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTCAACACCACGGCAAGGCGCCATTCTACCTCTATTACGGCATCACAGGAGGCGTGGCCATCTTCGGCTTCGCGGAGGCGTGGGCCGGGTTCTGGGT[C/T]
TCCGGCGACCTCAACGGCCGGCGCGCCGTCGGAAAGACGATACTGTGGGTGTCGATTTTGCCTCTCGTCTTGGTGGCTGCGCTCGGAGGGTTCGTCTTCA

Reverse complement sequence

TGAAGACGAACCCTCCGAGCGCAGCCACCAAGACGAGAGGCAAAATCGACACCCACAGTATCGTCTTTCCGACGGCGCGCCGGCCGTTGAGGTCGCCGGA[G/A]
ACCCAGAACCCGGCCCACGCCTCCGCGAAGCCGAAGATGGCCACGCCTCCTGTGATGCCGTAATAGAGGTAGAATGGCGCCTTGCCGTGGTGTTGAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 6.20% 0.55% 6.43% NA
All Indica  2759 92.60% 0.50% 0.62% 6.31% NA
All Japonica  1512 81.10% 12.00% 0.33% 6.55% NA
Aus  269 65.80% 27.10% 0.74% 6.32% NA
Indica I  595 98.50% 0.00% 0.00% 1.51% NA
Indica II  465 97.20% 0.00% 0.86% 1.94% NA
Indica III  913 86.90% 0.40% 0.55% 12.16% NA
Indica Intermediate  786 92.10% 1.10% 1.02% 5.73% NA
Temperate Japonica  767 94.80% 0.90% 0.13% 4.17% NA
Tropical Japonica  504 65.10% 31.30% 0.60% 2.98% NA
Japonica Intermediate  241 71.00% 7.10% 0.41% 21.58% NA
VI/Aromatic  96 72.90% 20.80% 1.04% 5.21% NA
Intermediate  90 82.20% 6.70% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431613586 C -> DEL LOC_Os04g53080.1 N frameshift_variant Average:88.056; most accessible tissue: Zhenshan97 flag leaf, score: 93.757 N N N N
vg0431613586 C -> T LOC_Os04g53080.1 synonymous_variant ; p.Val84Val; LOW synonymous_codon Average:88.056; most accessible tissue: Zhenshan97 flag leaf, score: 93.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431613586 C T -0.02 -0.02 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431613586 NA 1.45E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431613586 NA 5.76E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431613586 1.66E-06 NA mr1093_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431613586 NA 9.90E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431613586 8.42E-08 1.21E-06 mr1931_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251