Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431611699:

Variant ID: vg0431611699 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31611699
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGCTTATTTACGAGGAATGACTAGTAGCATGTTTAAATGGATGATAAGTAGAATTATTTATCCTTGGTCTATGTGTCAAGATGAAATATGACTATTAAA[A/G]
GTAGATGGAGGGAGTAATAATTACCGTAAGTAGCAGCGCAGGGGCGTTTTGCACGATGAGTGTGGGGGAGGGGGGTGCGCCCACTGTGCAAGTTAAACAG

Reverse complement sequence

CTGTTTAACTTGCACAGTGGGCGCACCCCCCTCCCCCACACTCATCGTGCAAAACGCCCCTGCGCTGCTACTTACGGTAATTATTACTCCCTCCATCTAC[T/C]
TTTAATAGTCATATTTCATCTTGACACATAGACCAAGGATAAATAATTCTACTTATCATCCATTTAAACATGCTACTAGTCATTCCTCGTAAATAAGCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	5.70%	1.16%	12.93%	NA
All Indica	2759	90.40%	0.40%	0.69%	8.52%	NA
All Japonica	1512	73.90%	7.10%	1.85%	17.20%	NA
Aus	269	27.50%	41.30%	1.12%	30.11%	NA
Indica I	595	96.80%	0.20%	0.34%	2.69%	NA
Indica II	465	95.70%	0.20%	0.22%	3.87%	NA
Indica III	913	85.20%	0.10%	0.99%	13.69%	NA
Indica Intermediate	786	88.40%	1.00%	0.89%	9.67%	NA
Temperate Japonica	767	89.60%	3.80%	0.91%	5.74%	NA
Tropical Japonica	504	60.70%	6.70%	2.38%	30.16%	NA
Japonica Intermediate	241	51.50%	18.30%	3.73%	26.56%	NA
VI/Aromatic	96	40.60%	35.40%	2.08%	21.88%	NA
Intermediate	90	75.60%	5.60%	3.33%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431611699	A -> DEL	N	N	silent_mutation	Average:70.024; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0431611699	A -> G	LOC_Os04g53070.1	upstream_gene_variant ; 865.0bp to feature; MODIFIER	silent_mutation	Average:70.024; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0431611699	A -> G	LOC_Os04g53080.1	upstream_gene_variant ; 1636.0bp to feature; MODIFIER	silent_mutation	Average:70.024; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0431611699	A -> G	LOC_Os04g53060.1	downstream_gene_variant ; 1830.0bp to feature; MODIFIER	silent_mutation	Average:70.024; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0431611699	A -> G	LOC_Os04g53070-LOC_Os04g53080	intergenic_region ; MODIFIER	silent_mutation	Average:70.024; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431611699	NA	1.94E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	7.91E-06	7.25E-08	mr1080	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	4.27E-08	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	2.41E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	1.73E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	8.28E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	1.50E-07	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	2.22E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431611699	NA	1.41E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251