Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431599562:

Variant ID: vg0431599562 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31599562
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCATTTACCGAACTTTACCCAAGTTTACAAACAAAACATTCCAACCATTTTCAAAACATTACAAATAAGGAATTTTGAATTATATTTTTTTTACGAAC[G/A]
TTATTTTGAATTATTCAGATTCGTAGTAAAAGTGATATCTACCTAACATCTCTTATATTTTATTTTAGGGCGAAGAAACTTGTATATAGCTCTTCTGCTT

Reverse complement sequence

AAGCAGAAGAGCTATATACAAGTTTCTTCGCCCTAAAATAAAATATAAGAGATGTTAGGTAGATATCACTTTTACTACGAATCTGAATAATTCAAAATAA[C/T]
GTTCGTAAAAAAAATATAATTCAAAATTCCTTATTTGTAATGTTTTGAAAATGGTTGGAATGTTTTGTTTGTAAACTTGGGTAAAGTTCGGTAAATGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	8.10%	0.87%	10.83%	NA
All Indica	2759	87.90%	1.10%	0.87%	10.15%	NA
All Japonica	1512	70.90%	14.70%	0.93%	13.43%	NA
Aus	269	63.20%	32.70%	0.00%	4.09%	NA
Indica I	595	94.30%	1.20%	1.01%	3.53%	NA
Indica II	465	86.00%	1.10%	0.43%	12.47%	NA
Indica III	913	85.50%	0.10%	0.22%	14.13%	NA
Indica Intermediate	786	87.00%	2.00%	1.78%	9.16%	NA
Temperate Japonica	767	86.70%	9.10%	0.65%	3.52%	NA
Tropical Japonica	504	56.00%	10.70%	1.19%	32.14%	NA
Japonica Intermediate	241	51.90%	41.10%	1.24%	5.81%	NA
VI/Aromatic	96	52.10%	35.40%	0.00%	12.50%	NA
Intermediate	90	82.20%	7.80%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431599562	G -> DEL	N	N	silent_mutation	Average:39.887; most accessible tissue: Callus, score: 91.123	N	N	N	N
vg0431599562	G -> A	LOC_Os04g53050.1	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:39.887; most accessible tissue: Callus, score: 91.123	N	N	N	N
vg0431599562	G -> A	LOC_Os04g53040.1	downstream_gene_variant ; 1778.0bp to feature; MODIFIER	silent_mutation	Average:39.887; most accessible tissue: Callus, score: 91.123	N	N	N	N
vg0431599562	G -> A	LOC_Os04g53040-LOC_Os04g53050	intergenic_region ; MODIFIER	silent_mutation	Average:39.887; most accessible tissue: Callus, score: 91.123	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431599562	NA	6.35E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431599562	9.17E-06	1.05E-13	mr1807	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431599562	NA	1.46E-09	mr1807	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431599562	NA	3.56E-09	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431599562	NA	2.66E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431599562	NA	4.13E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251