\
| Variant ID: vg0431597089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31597089 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )
GTTAAGATGATCCACGGTATAAAAGGGACCCCCCGGAAGGGTCGCAAGGCATCGAATCTTATTGCCAACACACCCACACAGCCTACAAAGCCGAAGTACG[C/T]
GGAGCCAACTCACCGGGAGGTCTTGTTGAATACATCGACTACGATCTCGTCGATACCATCGATTTCGTCTACTTCCATTGTAATCTGTGATTTTCCATCA
TGATGGAAAATCACAGATTACAATGGAAGTAGACGAAATCGATGGTATCGACGAGATCGTAGTCGATGTATTCAACAAGACCTCCCGGTGAGTTGGCTCC[G/A]
CGTACTTCGGCTTTGTAGGCTGTGTGGGTGTGTTGGCAATAAGATTCGATGCCTTGCGACCCTTCCGGGGGGTCCCTTTTATACCGTGGATCATCTTAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 0.60% | 1.76% | 4.76% | NA |
| All Indica | 2759 | 89.20% | 0.70% | 2.28% | 7.83% | NA |
| All Japonica | 1512 | 98.70% | 0.60% | 0.40% | 0.26% | NA |
| Aus | 269 | 95.90% | 0.00% | 4.09% | 0.00% | NA |
| Indica I | 595 | 96.80% | 1.00% | 0.84% | 1.34% | NA |
| Indica II | 465 | 95.10% | 0.20% | 0.86% | 3.87% | NA |
| Indica III | 913 | 81.80% | 0.00% | 3.61% | 14.57% | NA |
| Indica Intermediate | 786 | 88.40% | 1.70% | 2.67% | 7.25% | NA |
| Temperate Japonica | 767 | 98.00% | 1.00% | 0.52% | 0.39% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431597089 | C -> DEL | N | N | silent_mutation | Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0431597089 | C -> T | LOC_Os04g53050.1 | upstream_gene_variant ; 3032.0bp to feature; MODIFIER | silent_mutation | Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0431597089 | C -> T | LOC_Os04g53040.1 | intron_variant ; MODIFIER | silent_mutation | Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431597089 | 1.08E-06 | 4.79E-09 | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 2.54E-07 | 2.55E-10 | mr1088 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 2.87E-06 | 3.12E-07 | mr1103 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 9.69E-06 | 5.82E-08 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 4.21E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 9.23E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 4.32E-06 | 3.71E-11 | mr1213 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 9.04E-06 | 1.27E-06 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 2.90E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | 1.35E-06 | 1.42E-06 | mr1437 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 1.10E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 8.23E-06 | mr1949 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431597089 | NA | 7.22E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |