\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431597089:

Variant ID: vg0431597089 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31597089
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAGATGATCCACGGTATAAAAGGGACCCCCCGGAAGGGTCGCAAGGCATCGAATCTTATTGCCAACACACCCACACAGCCTACAAAGCCGAAGTACG[C/T]
GGAGCCAACTCACCGGGAGGTCTTGTTGAATACATCGACTACGATCTCGTCGATACCATCGATTTCGTCTACTTCCATTGTAATCTGTGATTTTCCATCA

Reverse complement sequence

TGATGGAAAATCACAGATTACAATGGAAGTAGACGAAATCGATGGTATCGACGAGATCGTAGTCGATGTATTCAACAAGACCTCCCGGTGAGTTGGCTCC[G/A]
CGTACTTCGGCTTTGTAGGCTGTGTGGGTGTGTTGGCAATAAGATTCGATGCCTTGCGACCCTTCCGGGGGGTCCCTTTTATACCGTGGATCATCTTAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 0.60% 1.76% 4.76% NA
All Indica  2759 89.20% 0.70% 2.28% 7.83% NA
All Japonica  1512 98.70% 0.60% 0.40% 0.26% NA
Aus  269 95.90% 0.00% 4.09% 0.00% NA
Indica I  595 96.80% 1.00% 0.84% 1.34% NA
Indica II  465 95.10% 0.20% 0.86% 3.87% NA
Indica III  913 81.80% 0.00% 3.61% 14.57% NA
Indica Intermediate  786 88.40% 1.70% 2.67% 7.25% NA
Temperate Japonica  767 98.00% 1.00% 0.52% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.83% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 93.30% 0.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431597089 C -> DEL N N silent_mutation Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431597089 C -> T LOC_Os04g53050.1 upstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431597089 C -> T LOC_Os04g53040.1 intron_variant ; MODIFIER silent_mutation Average:72.652; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431597089 1.08E-06 4.79E-09 mr1086 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 2.54E-07 2.55E-10 mr1088 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 2.87E-06 3.12E-07 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 9.69E-06 5.82E-08 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 4.21E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 9.23E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 4.32E-06 3.71E-11 mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 9.04E-06 1.27E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 2.90E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 1.35E-06 1.42E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 1.10E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 8.23E-06 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431597089 NA 7.22E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251