\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431566984:

Variant ID: vg0431566984 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31566984
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAAATAACTGTTTCGGGACTGTCATCAATCTTTTGATATGCTTGTTAGATCAGCTTATGTGGTTGGTGTTAACTAGAAAACCAGATGATGTTTGCCTA[C/A]
AGAATTCAAGAAGTTGAATCTCTATCCCTTTTGTTTAAGCATCACTTAATTTCCTATTCTATTTTTTATCTTTGACTGCAGTTGGCGTGCTGTGGGTGGC

Reverse complement sequence

GCCACCCACAGCACGCCAACTGCAGTCAAAGATAAAAAATAGAATAGGAAATTAAGTGATGCTTAAACAAAAGGGATAGAGATTCAACTTCTTGAATTCT[G/T]
TAGGCAAACATCATCTGGTTTTCTAGTTAACACCAACCACATAAGCTGATCTAACAAGCATATCAAAAGATTGATGACAGTCCCGAAACAGTTATTTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 6.20% 1.08% 0.72% NA
All Indica  2759 86.50% 10.50% 1.70% 1.23% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.10% 0.00% 2.69% 0.17% NA
Indica II  465 60.20% 36.80% 3.01% 0.00% NA
Indica III  913 95.10% 2.10% 0.33% 2.52% NA
Indica Intermediate  786 84.10% 12.80% 1.78% 1.27% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431566984 C -> DEL N N silent_mutation Average:46.634; most accessible tissue: Callus, score: 86.147 N N N N
vg0431566984 C -> A LOC_Os04g52990.1 upstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:46.634; most accessible tissue: Callus, score: 86.147 N N N N
vg0431566984 C -> A LOC_Os04g53010.1 upstream_gene_variant ; 2301.0bp to feature; MODIFIER silent_mutation Average:46.634; most accessible tissue: Callus, score: 86.147 N N N N
vg0431566984 C -> A LOC_Os04g53000.1 downstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:46.634; most accessible tissue: Callus, score: 86.147 N N N N
vg0431566984 C -> A LOC_Os04g53000-LOC_Os04g53010 intergenic_region ; MODIFIER silent_mutation Average:46.634; most accessible tissue: Callus, score: 86.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431566984 NA 1.94E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 3.36E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 3.42E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 1.08E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 7.85E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 9.66E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 3.69E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 1.09E-13 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 2.54E-12 mr1174_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 5.37E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 6.05E-12 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 4.33E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 6.19E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431566984 NA 4.82E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251