\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431516737:

Variant ID: vg0431516737 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31516737
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGAAAAAGGACCTTTCCTGATCAGAGAGTAGGATCAGTACGGCACAATTTAACGACTATACTCCATAATATGGGCGGCTGCGACCCAAAATAACACA[C/A]
AGATTTTGTTTTGGTGAGAGCTGGACGACGTCAGCGCTTACGACCAATCAGGGCGTACACTGCCGGAGGAGCGAGAAGTCAGAGAGTGATCATCTCAAAG

Reverse complement sequence

CTTTGAGATGATCACTCTCTGACTTCTCGCTCCTCCGGCAGTGTACGCCCTGATTGGTCGTAAGCGCTGACGTCGTCCAGCTCTCACCAAAACAAAATCT[G/T]
TGTGTTATTTTGGGTCGCAGCCGCCCATATTATGGAGTATAGTCGTTAAATTGTGCCGTACTGATCCTACTCTCTGATCAGGAAAGGTCCTTTTTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 42.00% 0.04% 0.00% NA
All Indica  2759 72.80% 27.10% 0.07% 0.00% NA
All Japonica  1512 37.00% 63.00% 0.00% 0.00% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 81.70% 18.20% 0.17% 0.00% NA
Indica II  465 77.80% 22.20% 0.00% 0.00% NA
Indica III  913 62.90% 37.10% 0.00% 0.00% NA
Indica Intermediate  786 74.60% 25.30% 0.13% 0.00% NA
Temperate Japonica  767 7.30% 92.70% 0.00% 0.00% NA
Tropical Japonica  504 87.70% 12.30% 0.00% 0.00% NA
Japonica Intermediate  241 25.70% 74.30% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431516737 C -> A LOC_Os04g52900.1 upstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:89.201; most accessible tissue: Callus, score: 99.771 N N N N
vg0431516737 C -> A LOC_Os04g52900.2 upstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:89.201; most accessible tissue: Callus, score: 99.771 N N N N
vg0431516737 C -> A LOC_Os04g52910.1 downstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:89.201; most accessible tissue: Callus, score: 99.771 N N N N
vg0431516737 C -> A LOC_Os04g52900-LOC_Os04g52910 intergenic_region ; MODIFIER silent_mutation Average:89.201; most accessible tissue: Callus, score: 99.771 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431516737 C A 0.06 0.03 0.02 0.01 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431516737 NA 8.47E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 1.12E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 5.91E-09 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 4.94E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 4.15E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 2.86E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431516737 NA 5.80E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251