\
| Variant ID: vg0431516011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31516011 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTTTTATTACTGTAACTTGATTTATCATCTTGAAACATTATTACTTAATATTTTATATTTATAAAAAACAAAATAAATGGTCAAACGTTTGTTAAAAA[G/A]
TCAACGATGTTATATATTAAAAAAACAGAGGTAGTAACTTTTAAAGTTTAAATTTTATTTAAAATATAATAATTTTTTCACTTTTCACATATATTTTCTT
AAGAAAATATATGTGAAAAGTGAAAAAATTATTATATTTTAAATAAAATTTAAACTTTAAAAGTTACTACCTCTGTTTTTTTAATATATAACATCGTTGA[C/T]
TTTTTAACAAACGTTTGACCATTTATTTTGTTTTTTATAAATATAAAATATTAAGTAATAATGTTTCAAGATGATAAATCAAGTTACAGTAATAAAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 5.70% | 0.17% | 2.18% | NA |
| All Indica | 2759 | 95.60% | 1.70% | 0.14% | 2.54% | NA |
| All Japonica | 1512 | 86.20% | 11.40% | 0.20% | 2.12% | NA |
| Aus | 269 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 1.30% | 0.50% | 2.52% | NA |
| Indica II | 465 | 90.50% | 7.10% | 0.22% | 2.15% | NA |
| Indica III | 913 | 97.80% | 0.00% | 0.00% | 2.19% | NA |
| Indica Intermediate | 786 | 96.10% | 0.80% | 0.00% | 3.18% | NA |
| Temperate Japonica | 767 | 92.70% | 2.90% | 0.39% | 4.04% | NA |
| Tropical Japonica | 504 | 74.80% | 25.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431516011 | G -> DEL | N | N | silent_mutation | Average:44.62; most accessible tissue: Callus, score: 83.839 | N | N | N | N |
| vg0431516011 | G -> A | LOC_Os04g52900.1 | upstream_gene_variant ; 1703.0bp to feature; MODIFIER | silent_mutation | Average:44.62; most accessible tissue: Callus, score: 83.839 | N | N | N | N |
| vg0431516011 | G -> A | LOC_Os04g52900.2 | upstream_gene_variant ; 1703.0bp to feature; MODIFIER | silent_mutation | Average:44.62; most accessible tissue: Callus, score: 83.839 | N | N | N | N |
| vg0431516011 | G -> A | LOC_Os04g52910.1 | downstream_gene_variant ; 3232.0bp to feature; MODIFIER | silent_mutation | Average:44.62; most accessible tissue: Callus, score: 83.839 | N | N | N | N |
| vg0431516011 | G -> A | LOC_Os04g52900-LOC_Os04g52910 | intergenic_region ; MODIFIER | silent_mutation | Average:44.62; most accessible tissue: Callus, score: 83.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431516011 | 1.16E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431516011 | 9.71E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431516011 | 5.17E-07 | NA | mr1233 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431516011 | NA | 1.78E-07 | mr1233 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431516011 | 9.30E-07 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431516011 | 4.77E-06 | NA | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |