Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431473218:

Variant ID: vg0431473218 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31473218
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CACCAGGTGCACAAGGATAAGGCCTGGTTAAGGCCTGGTTTAGCGCTTTTTTTTTTCGAACTTTCAACTTTTTCATTATATTAAAAATTTCCTACATACA[A/G]
ATTTTTAACTTTTCCATCACATCGTTTTAATTTCAATTAAACTATTAATTTTAACGTGAACTAAGCACGCGCTAAATTGGATAACGAGACGGACAACTCG

Reverse complement sequence

CGAGTTGTCCGTCTCGTTATCCAATTTAGCGCGTGCTTAGTTCACGTTAAAATTAATAGTTTAATTGAAATTAAAACGATGTGATGGAAAAGTTAAAAAT[T/C]
TGTATGTAGGAAATTTTTAATATAATGAAAAAGTTGAAAGTTCGAAAAAAAAAAGCGCTAAACCAGGCCTTAACCAGGCCTTATCCTTGTGCACCTGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 20.40% 0.19% 0.00% NA
All Indica  2759 79.80% 20.00% 0.22% 0.00% NA
All Japonica  1512 82.10% 17.90% 0.07% 0.00% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 88.70% 11.30% 0.00% 0.00% NA
Indica II  465 80.60% 19.40% 0.00% 0.00% NA
Indica III  913 77.50% 22.20% 0.22% 0.00% NA
Indica Intermediate  786 75.10% 24.40% 0.51% 0.00% NA
Temperate Japonica  767 96.70% 3.10% 0.13% 0.00% NA
Tropical Japonica  504 58.70% 41.30% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 24.00% 1.04% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431473218 A -> G LOC_Os04g52850.1 upstream_gene_variant ; 1156.0bp to feature; MODIFIER silent_mutation Average:96.605; most accessible tissue: Callus, score: 98.977 N N N N
vg0431473218 A -> G LOC_Os04g52840-LOC_Os04g52850 intergenic_region ; MODIFIER silent_mutation Average:96.605; most accessible tissue: Callus, score: 98.977 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431473218 A G 0.0 -0.02 0.0 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431473218 NA 1.76E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.67E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.38E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 5.32E-06 5.32E-06 mr1146_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.32E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 2.41E-06 mr1295_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.21E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.15E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 6.10E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 7.37E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 1.17E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 7.89E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 1.18E-07 NA mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431473218 NA 3.34E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251