Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431453051:

Variant ID: vg0431453051 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31453051
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCTTGCCCCTAGATCAGGGGCTACCTATCTATGATCATACCACTACTAATATTTTTTCCTGCTATCTTTCTCTACAGTTGATGCATTATAATACTTC[G/A]
CTGTGATCTTTGAAGATCTAAGGCGTATCTGCGGACGAGCCTAAAAAAGCTTTCTTATGAGCTCCCCAATTTATAAAGTCTCCTCAGGTCGATAGCGGCC

Reverse complement sequence

GGCCGCTATCGACCTGAGGAGACTTTATAAATTGGGGAGCTCATAAGAAAGCTTTTTTAGGCTCGTCCGCAGATACGCCTTAGATCTTCAAAGATCACAG[C/T]
GAAGTATTATAATGCATCAACTGTAGAGAAAGATAGCAGGAAAAAATATTAGTAGTGGTATGATCATAGATAGGTAGCCCCTGATCTAGGGGCAAGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.60% 0.13% 0.00% NA
All Indica  2759 92.00% 7.80% 0.14% 0.00% NA
All Japonica  1512 72.00% 27.80% 0.13% 0.00% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 91.30% 8.60% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 89.30% 10.50% 0.22% 0.00% NA
Indica Intermediate  786 91.90% 8.00% 0.13% 0.00% NA
Temperate Japonica  767 85.90% 14.00% 0.13% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 36.90% 62.70% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431453051 G -> A LOC_Os04g52820.1 downstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:86.076; most accessible tissue: Callus, score: 99.547 N N N N
vg0431453051 G -> A LOC_Os04g52820-LOC_Os04g52830 intergenic_region ; MODIFIER silent_mutation Average:86.076; most accessible tissue: Callus, score: 99.547 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431453051 G A -0.1 -0.07 -0.06 -0.04 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431453051 NA 4.23E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 6.47E-06 6.47E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 6.87E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 5.82E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 4.18E-06 3.79E-07 mr1505_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 3.29E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 2.51E-06 2.51E-06 mr1569_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 8.52E-06 8.52E-06 mr1573_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 8.34E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 4.15E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431453051 NA 8.98E-06 mr1956_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251