\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431444640:

Variant ID: vg0431444640 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31444640
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, T: 0.01, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


AATCCCTTATATTATGGGACGGAGGGAGTATCAGTCAAACATTAACCTAGATATAACAGCCAAATCATATGAGAATTTGAAGTCACATATCACATCCGAT[C/A]
CGTTCAGCCGTCAGATATCCCTTCCCGTATACTCCATCCGTCCCATTATTAGGGTAATAATGAGTTTTCGTGTTTAATCTTGATCGTCCATCTTATTAAA

Reverse complement sequence

TTTAATAAGATGGACGATCAAGATTAAACACGAAAACTCATTATTACCCTAATAATGGGACGGATGGAGTATACGGGAAGGGATATCTGACGGCTGAACG[G/T]
ATCGGATGTGATATGTGACTTCAAATTCTCATATGATTTGGCTGTTATATCTAGGTTAATGTTTGACTGATACTCCCTCCGTCCCATAATATAAGGGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 44.00% 0.66% 2.79% NA
All Indica  2759 59.30% 35.60% 0.62% 4.42% NA
All Japonica  1512 45.00% 54.80% 0.13% 0.13% NA
Aus  269 41.60% 56.10% 1.49% 0.74% NA
Indica I  595 70.60% 28.70% 0.67% 0.00% NA
Indica II  465 80.90% 15.30% 0.43% 3.44% NA
Indica III  913 40.70% 50.10% 0.44% 8.76% NA
Indica Intermediate  786 59.70% 36.10% 0.89% 3.31% NA
Temperate Japonica  767 78.60% 21.40% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.00% 0.00% 0.40% NA
Japonica Intermediate  241 24.50% 74.70% 0.83% 0.00% NA
VI/Aromatic  96 17.70% 75.00% 7.29% 0.00% NA
Intermediate  90 42.20% 50.00% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431444640 C -> DEL N N silent_mutation Average:55.657; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0431444640 C -> A LOC_Os04g52810.1 upstream_gene_variant ; 1243.0bp to feature; MODIFIER silent_mutation Average:55.657; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0431444640 C -> A LOC_Os04g52820.1 upstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:55.657; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0431444640 C -> A LOC_Os04g52810-LOC_Os04g52820 intergenic_region ; MODIFIER silent_mutation Average:55.657; most accessible tissue: Minghui63 root, score: 77.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431444640 NA 5.54E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431444640 NA 5.34E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431444640 NA 7.76E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 2.41E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 4.39E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 8.96E-06 8.93E-06 mr1340 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 6.89E-06 6.87E-06 mr1429 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 1.72E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 4.94E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 2.50E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 1.30E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 6.71E-15 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 7.25E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 6.93E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 9.84E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 1.70E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 8.04E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 1.59E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 2.75E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 1.54E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 3.49E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431444640 NA 2.56E-11 mr1952_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251