\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431440861:

Variant ID: vg0431440861 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31440861
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTC[C/T]
CATCTAAATAGGGCCTTAAATCATCATTTAACAGAACAACTAACAACTTGGAATAAAGAATCTGTGCTATAAAAGCAGTCAAATCCTTTTCAAATTGTTC

Reverse complement sequence

GAACAATTTGAAAAGGATTTGACTGCTTTTATAGCACAGATTCTTTATTCCAAGTTGTTAGTTGTTCTGTTAAATGATGATTTAAGGCCCTATTTAGATG[G/A]
GACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 7.40% 1.31% 41.77% NA
All Indica  2759 48.00% 0.40% 1.05% 50.56% NA
All Japonica  1512 45.20% 21.50% 0.73% 32.61% NA
Aus  269 70.30% 1.50% 7.06% 21.19% NA
Indica I  595 47.40% 0.20% 1.01% 51.43% NA
Indica II  465 19.60% 1.10% 1.08% 78.28% NA
Indica III  913 62.20% 0.10% 0.55% 37.13% NA
Indica Intermediate  786 48.60% 0.60% 1.65% 49.11% NA
Temperate Japonica  767 57.20% 0.30% 0.65% 41.85% NA
Tropical Japonica  504 16.70% 60.90% 0.79% 21.63% NA
Japonica Intermediate  241 66.40% 6.60% 0.83% 26.14% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 55.60% 11.10% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431440861 C -> DEL N N silent_mutation Average:75.437; most accessible tissue: Minghui63 root, score: 96.682 N N N N
vg0431440861 C -> T LOC_Os04g52800.1 upstream_gene_variant ; 4906.0bp to feature; MODIFIER silent_mutation Average:75.437; most accessible tissue: Minghui63 root, score: 96.682 N N N N
vg0431440861 C -> T LOC_Os04g52810.1 intron_variant ; MODIFIER silent_mutation Average:75.437; most accessible tissue: Minghui63 root, score: 96.682 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431440861 C T -0.01 -0.04 -0.02 -0.01 -0.03 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431440861 NA 1.67E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 2.34E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 1.83E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 8.68E-07 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 9.81E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 5.87E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 3.13E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 3.58E-06 3.58E-06 mr1601 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 8.25E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 5.88E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 1.05E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431440861 NA 5.79E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251