\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431429842:

Variant ID: vg0431429842 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31429842
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGCATCGAGAACCGAGCGTTGCTCGGTTGGCTAGCATCGCTGGTGAGCGAGCAGCCCGCGCGGGTTCGATCCCTGGGATCATCATCCGCGCGTCTCAC[C/A]
GGGATTTATTCCCAAATAAATTTCCAGCTCTCCTGTGCCAGCGCCACAATAGTAGAGTGACGTCCTCGTCACGCACAAGGTTCTTAGGTGGCTTTGTGCA

Reverse complement sequence

TGCACAAAGCCACCTAAGAACCTTGTGCGTGACGAGGACGTCACTCTACTATTGTGGCGCTGGCACAGGAGAGCTGGAAATTTATTTGGGAATAAATCCC[G/T]
GTGAGACGCGCGGATGATGATCCCAGGGATCGAACCCGCGCGGGCTGCTCGCTCACCAGCGATGCTAGCCAACCGAGCAACGCTCGGTTCTCGATGCCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 9.80% 0.42% 1.57% NA
All Indica  2759 92.00% 6.30% 0.54% 1.16% NA
All Japonica  1512 84.80% 15.00% 0.20% 0.00% NA
Aus  269 84.80% 0.40% 0.37% 14.50% NA
Indica I  595 91.10% 8.10% 0.50% 0.34% NA
Indica II  465 98.30% 0.90% 0.00% 0.86% NA
Indica III  913 90.00% 7.30% 0.22% 2.41% NA
Indica Intermediate  786 91.10% 7.10% 1.27% 0.51% NA
Temperate Japonica  767 86.70% 13.00% 0.26% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 64.30% 35.30% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 50.00% 0.00% 1.04% NA
Intermediate  90 83.30% 13.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431429842 C -> DEL N N silent_mutation Average:93.646; most accessible tissue: Zhenshan97 flag leaf, score: 97.52 N N N N
vg0431429842 C -> A LOC_Os04g52780.1 upstream_gene_variant ; 4750.0bp to feature; MODIFIER silent_mutation Average:93.646; most accessible tissue: Zhenshan97 flag leaf, score: 97.52 N N N N
vg0431429842 C -> A LOC_Os04g52790.1 downstream_gene_variant ; 2592.0bp to feature; MODIFIER silent_mutation Average:93.646; most accessible tissue: Zhenshan97 flag leaf, score: 97.52 N N N N
vg0431429842 C -> A LOC_Os04g52780-LOC_Os04g52790 intergenic_region ; MODIFIER silent_mutation Average:93.646; most accessible tissue: Zhenshan97 flag leaf, score: 97.52 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431429842 C A -0.08 -0.1 -0.03 -0.01 -0.06 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431429842 NA 1.49E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 3.77E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 6.45E-06 6.45E-06 mr1290_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.08E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 6.72E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 5.66E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 3.40E-06 3.40E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.55E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 7.82E-06 7.82E-06 mr1387_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.47E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 6.79E-06 6.79E-06 mr1500_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 6.62E-06 4.94E-07 mr1505_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.56E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 9.15E-06 9.15E-06 mr1569_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 3.24E-06 3.24E-06 mr1573_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 8.95E-06 mr1612_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 4.79E-07 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.37E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 6.77E-06 6.77E-06 mr1783_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 7.96E-06 mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 3.37E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 1.90E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 3.79E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 6.28E-06 mr1956_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431429842 NA 4.18E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251