Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431376032:

Variant ID: vg0431376032 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31376032
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCTCGTTTTAATTTATTAGTCCTCTCCTCTCCTGATAATGTACTCCCTCCGTCCCAAAAAAAGGCAAACCGTAGGTTCCCGTGCCAACGTTTAACTGTC[C/T]
GTCTTATATGAAATTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATACTTTATGCGTGACTTATCTTTTTAATTTTCTTCA

Reverse complement sequence

TGAAGAAAATTAAAAAGATAAGTCACGCATAAAGTATTAATCATGTTTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAATTTCATATAAGAC[G/A]
GACAGTTAAACGTTGGCACGGGAACCTACGGTTTGCCTTTTTTTGGGACGGAGGGAGTACATTATCAGGAGAGGAGAGGACTAATAAATTAAAACGAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.70%	12.20%	0.08%	0.00%	NA
All Indica	2759	97.70%	2.10%	0.14%	0.00%	NA
All Japonica	1512	72.40%	27.60%	0.00%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	98.50%	0.90%	0.65%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.80%	0.13%	0.00%	NA
Temperate Japonica	767	96.30%	3.70%	0.00%	0.00%	NA
Tropical Japonica	504	31.50%	68.50%	0.00%	0.00%	NA
Japonica Intermediate	241	81.30%	18.70%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431376032	C -> T	LOC_Os04g52700.1	downstream_gene_variant ; 3233.0bp to feature; MODIFIER	silent_mutation	Average:56.112; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0431376032	C -> T	LOC_Os04g52690-LOC_Os04g52700	intergenic_region ; MODIFIER	silent_mutation	Average:56.112; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431376032	NA	7.00E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	9.85E-08	NA	mr1113_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	1.86E-08	NA	mr1114_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	1.91E-14	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	1.20E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	3.41E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	1.83E-09	NA	mr1120_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	4.48E-08	NA	mr1123_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	7.25E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	8.61E-07	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	2.92E-08	NA	mr1242_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	4.11E-10	NA	mr1247_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	5.83E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	2.85E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	2.14E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	3.19E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	4.52E-12	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	9.93E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	5.00E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	3.53E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	4.46E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	2.41E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	4.32E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	3.91E-07	NA	mr1936_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431376032	NA	1.31E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251