\
| Variant ID: vg0431372747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31372747 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGCCTCCAATAATCTAAAGAAACAAACAATTCATAGCTTATTCTATGTCAGCTTATTATAATCCAGCTTAGAGTAATATGATTTAATAATCTAGATTA[C/T]
AATAATCTTAAGCGGAAACAAACAGGGCCTTACATTGTGAAACGGAGGAAGTACACACTTAGGAGAAAAATCACGAGACGAATCTTTTTAGCATAATTAG
CTAATTATGCTAAAAAGATTCGTCTCGTGATTTTTCTCCTAAGTGTGTACTTCCTCCGTTTCACAATGTAAGGCCCTGTTTGTTTCCGCTTAAGATTATT[G/A]
TAATCTAGATTATTAAATCATATTACTCTAAGCTGGATTATAATAAGCTGACATAGAATAAGCTATGAATTGTTTGTTTCTTTAGATTATTGGAGGCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 7.90% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 5.50% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 89.00% | 10.00% | 1.06% | 0.00% | NA |
| Aus | 269 | 92.90% | 5.90% | 1.12% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.70% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.70% | 9.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.70% | 7.30% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 91.70% | 6.80% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 32.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 47.90% | 52.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431372747 | C -> T | LOC_Os04g52690.1 | upstream_gene_variant ; 3260.0bp to feature; MODIFIER | silent_mutation | Average:45.756; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0431372747 | C -> T | LOC_Os04g52690.2 | upstream_gene_variant ; 3348.0bp to feature; MODIFIER | silent_mutation | Average:45.756; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0431372747 | C -> T | LOC_Os04g52690.3 | upstream_gene_variant ; 3348.0bp to feature; MODIFIER | silent_mutation | Average:45.756; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0431372747 | C -> T | LOC_Os04g52690-LOC_Os04g52700 | intergenic_region ; MODIFIER | silent_mutation | Average:45.756; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431372747 | 9.31E-06 | 9.31E-06 | mr1426 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431372747 | 4.85E-06 | 4.85E-06 | mr1915 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |