\
| Variant ID: vg0431358556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31358556 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 122. )
GGACGACGGGAATAAGGTGTTGCACTTGCACCCACCAAACCGGCTTTTAACAAATTGGTTAAGAAATTTCGGTCACACACGTTTCTCAAACTAATAAACG[A/G,T]
TATATTTTAAACAAATTATAGATAAATTACTTTAAAAAATCATACTAATCTATTTTCATTTTTTTAGCTAATACAAAATTAATTATACACTAATCTATCC
GGATAGATTAGTGTATAATTAATTTTGTATTAGCTAAAAAAATGAAAATAGATTAGTATGATTTTTTAAAGTAATTTATCTATAATTTGTTTAAAATATA[T/C,A]
CGTTTATTAGTTTGAGAAACGTGTGTGACCGAAATTTCTTAACCAATTTGTTAAAAGCCGGTTTGGTGGGTGCAAGTGCAACACCTTATTCCCGTCGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 17.20% | 0.08% | 0.00% | T: 0.30% |
| All Indica | 2759 | 95.40% | 4.00% | 0.07% | 0.00% | T: 0.51% |
| All Japonica | 1512 | 54.60% | 45.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 0.00% | 0.00% | 0.00% | T: 1.31% |
| Indica Intermediate | 786 | 94.30% | 5.20% | 0.25% | 0.00% | T: 0.25% |
| Temperate Japonica | 767 | 18.00% | 81.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431358556 | A -> G | LOC_Os04g52680.1 | downstream_gene_variant ; 3353.0bp to feature; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| vg0431358556 | A -> G | LOC_Os04g52684.1 | downstream_gene_variant ; 528.0bp to feature; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| vg0431358556 | A -> G | LOC_Os04g52684-LOC_Os04g52690 | intergenic_region ; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| vg0431358556 | A -> T | LOC_Os04g52680.1 | downstream_gene_variant ; 3353.0bp to feature; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| vg0431358556 | A -> T | LOC_Os04g52684.1 | downstream_gene_variant ; 528.0bp to feature; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| vg0431358556 | A -> T | LOC_Os04g52684-LOC_Os04g52690 | intergenic_region ; MODIFIER | silent_mutation | Average:70.023; most accessible tissue: Callus, score: 85.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431358556 | NA | 3.30E-15 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431358556 | NA | 3.25E-13 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431358556 | NA | 3.86E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.39E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.00E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.96E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.16E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.38E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.56E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 8.86E-08 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 5.73E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.20E-08 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 5.71E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 8.24E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 3.17E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 3.36E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.02E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.31E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 8.02E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.03E-09 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.37E-06 | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.61E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 7.07E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 4.15E-09 | mr1482 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 7.73E-06 | mr1482 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.05E-08 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.46E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 7.49E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.32E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.35E-12 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 4.93E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 4.49E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.38E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.56E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.96E-06 | mr1751 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.27E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.66E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 3.82E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.65E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.58E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.02E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 5.55E-16 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 9.02E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 7.81E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.92E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 4.34E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.22E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.69E-08 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.70E-10 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.22E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 3.45E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.95E-11 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 2.39E-09 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 1.74E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 8.17E-09 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431358556 | NA | 6.48E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |