\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431298826:

Variant ID: vg0431298826 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31298826
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTGAGTTGGCATCGAAATTTGAGGAGAGAGAGGGTGAGCCGGCGACTAATTAGTCGCCGACTCCACGCGTGTGCCGAGGCAAGAAAAGCAACAGCATG[C/T]
GTTTTCTTACTGGACCATGCAGTTGTGGGGTCCACGTGATTTGTAGTCTGTAGATGAGAAGATAACACGTGTAGACATGACACTATAAAAAAAAAAGAAA

Reverse complement sequence

TTTCTTTTTTTTTTATAGTGTCATGTCTACACGTGTTATCTTCTCATCTACAGACTACAAATCACGTGGACCCCACAACTGCATGGTCCAGTAAGAAAAC[G/A]
CATGCTGTTGCTTTTCTTGCCTCGGCACACGCGTGGAGTCGGCGACTAATTAGTCGCCGGCTCACCCTCTCTCTCCTCAAATTTCGATGCCAACTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 15.40% 4.91% 6.54% NA
All Indica  2759 91.90% 5.40% 1.81% 0.91% NA
All Japonica  1512 52.80% 19.40% 9.66% 18.19% NA
Aus  269 13.00% 77.70% 8.18% 1.12% NA
Indica I  595 81.50% 11.40% 3.53% 3.53% NA
Indica II  465 97.40% 1.50% 0.43% 0.65% NA
Indica III  913 95.70% 3.20% 1.10% 0.00% NA
Indica Intermediate  786 92.00% 5.70% 2.16% 0.13% NA
Temperate Japonica  767 82.30% 0.50% 3.39% 13.82% NA
Tropical Japonica  504 15.70% 51.40% 11.71% 21.23% NA
Japonica Intermediate  241 36.50% 12.40% 25.31% 25.73% NA
VI/Aromatic  96 20.80% 67.70% 7.29% 4.17% NA
Intermediate  90 74.40% 15.60% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431298826 C -> DEL N N silent_mutation Average:70.649; most accessible tissue: Callus, score: 97.783 N N N N
vg0431298826 C -> T LOC_Os04g52614.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:70.649; most accessible tissue: Callus, score: 97.783 N N N N
vg0431298826 C -> T LOC_Os04g52606-LOC_Os04g52614 intergenic_region ; MODIFIER silent_mutation Average:70.649; most accessible tissue: Callus, score: 97.783 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431298826 C T -0.07 -0.14 -0.19 -0.06 -0.09 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431298826 NA 5.82E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 7.10E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 3.64E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 1.78E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 9.76E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 9.09E-09 mr1363_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 5.82E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 4.59E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 9.63E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 8.90E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 5.71E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 8.32E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 5.32E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431298826 NA 5.45E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251