Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431259186:

Variant ID: vg0431259186 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31259186
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTAAACGATGTCCCATGACAACACAATGTTGTCAATTTAACTGAAATGAAAGATGTCTAGGAAATATTATATAGAGTAAAGTTCATCACCGGTCCCT[A/G]
AACTTATACCGCTGTGTCATCCCGGTCCCTAAACTCGCAAATCGACCGTTCAGGTCCTCAAACTTATACCGCTGTGTCATCCCGGTCCCTAAACTCGTAA

Reverse complement sequence

TTACGAGTTTAGGGACCGGGATGACACAGCGGTATAAGTTTGAGGACCTGAACGGTCGATTTGCGAGTTTAGGGACCGGGATGACACAGCGGTATAAGTT[T/C]
AGGGACCGGTGATGAACTTTACTCTATATAATATTTCCTAGACATCTTTCATTTCAGTTAAATTGACAACATTGTGTTGTCATGGGACATCGTTTAATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	17.40%	0.34%	0.00%	NA
All Indica	2759	71.60%	27.90%	0.47%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	97.40%	1.90%	0.74%	0.00%	NA
Indica I	595	87.20%	12.10%	0.67%	0.00%	NA
Indica II	465	45.40%	53.80%	0.86%	0.00%	NA
Indica III	913	74.80%	25.00%	0.22%	0.00%	NA
Indica Intermediate	786	71.60%	28.00%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431259186	A -> G	LOC_Os04g52570.1	upstream_gene_variant ; 1252.0bp to feature; MODIFIER	silent_mutation	Average:72.716; most accessible tissue: Minghui63 root, score: 84.069	N	N	N	N
vg0431259186	A -> G	LOC_Os04g52580.1	downstream_gene_variant ; 909.0bp to feature; MODIFIER	silent_mutation	Average:72.716; most accessible tissue: Minghui63 root, score: 84.069	N	N	N	N
vg0431259186	A -> G	LOC_Os04g52590.1	downstream_gene_variant ; 3907.0bp to feature; MODIFIER	silent_mutation	Average:72.716; most accessible tissue: Minghui63 root, score: 84.069	N	N	N	N
vg0431259186	A -> G	LOC_Os04g52570-LOC_Os04g52580	intergenic_region ; MODIFIER	silent_mutation	Average:72.716; most accessible tissue: Minghui63 root, score: 84.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431259186	NA	3.57E-13	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	2.53E-10	mr1174	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	5.68E-07	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	1.50E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	1.12E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	1.29E-11	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	7.32E-10	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	1.58E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186	NA	3.73E-08	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251