\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431259186:

Variant ID: vg0431259186 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31259186
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTAAACGATGTCCCATGACAACACAATGTTGTCAATTTAACTGAAATGAAAGATGTCTAGGAAATATTATATAGAGTAAAGTTCATCACCGGTCCCT[A/G]
AACTTATACCGCTGTGTCATCCCGGTCCCTAAACTCGCAAATCGACCGTTCAGGTCCTCAAACTTATACCGCTGTGTCATCCCGGTCCCTAAACTCGTAA

Reverse complement sequence

TTACGAGTTTAGGGACCGGGATGACACAGCGGTATAAGTTTGAGGACCTGAACGGTCGATTTGCGAGTTTAGGGACCGGGATGACACAGCGGTATAAGTT[T/C]
AGGGACCGGTGATGAACTTTACTCTATATAATATTTCCTAGACATCTTTCATTTCAGTTAAATTGACAACATTGTGTTGTCATGGGACATCGTTTAATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 17.40% 0.34% 0.00% NA
All Indica  2759 71.60% 27.90% 0.47% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 97.40% 1.90% 0.74% 0.00% NA
Indica I  595 87.20% 12.10% 0.67% 0.00% NA
Indica II  465 45.40% 53.80% 0.86% 0.00% NA
Indica III  913 74.80% 25.00% 0.22% 0.00% NA
Indica Intermediate  786 71.60% 28.00% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431259186 A -> G LOC_Os04g52570.1 upstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:72.716; most accessible tissue: Minghui63 root, score: 84.069 N N N N
vg0431259186 A -> G LOC_Os04g52580.1 downstream_gene_variant ; 909.0bp to feature; MODIFIER silent_mutation Average:72.716; most accessible tissue: Minghui63 root, score: 84.069 N N N N
vg0431259186 A -> G LOC_Os04g52590.1 downstream_gene_variant ; 3907.0bp to feature; MODIFIER silent_mutation Average:72.716; most accessible tissue: Minghui63 root, score: 84.069 N N N N
vg0431259186 A -> G LOC_Os04g52570-LOC_Os04g52580 intergenic_region ; MODIFIER silent_mutation Average:72.716; most accessible tissue: Minghui63 root, score: 84.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431259186 NA 3.57E-13 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 2.53E-10 mr1174 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 5.68E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 1.50E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 1.12E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 1.29E-11 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 7.32E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 1.58E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431259186 NA 3.73E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251