Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431236819:

Variant ID: vg0431236819 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 31236819
Reference Allele: A	Alternative Allele: G,AG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTTGCATCGTAACTCTGTAAGAAAATTTTGATGAAAAATCAATATTTATTAGTACTAATTACAAAAAAGAACAAGTATTATAAAAATGATAGATTA[A/G,AG]
ATATGTTTGAAATATTGTGAAAATAATACGAGAGGTGATGATTGGATATGCTTACACGTTGATTTGTACATTTTAATAAATTATAGATTATGTTGTATAA

Reverse complement sequence

TTATACAACATAATCTATAATTTATTAAAATGTACAAATCAACGTGTAAGCATATCCAATCATCACCTCTCGTATTATTTTCACAATATTTCAAACATAT[T/C,CT]
TAATCTATCATTTTTATAATACTTGTTCTTTTTTGTAATTAGTACTAATAAATATTGATTTTTCATCAAAATTTTCTTACAGAGTTACGATGCAAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	17.10%	3.68%	2.45%	AG: 0.49%
All Indica	2759	86.00%	3.30%	5.91%	3.99%	AG: 0.80%
All Japonica	1512	53.70%	46.20%	0.00%	0.07%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	94.80%	4.40%	0.67%	0.17%	NA
Indica II	465	84.30%	3.70%	5.38%	6.02%	AG: 0.65%
Indica III	913	81.20%	0.00%	10.41%	6.90%	AG: 1.53%
Indica Intermediate	786	85.90%	6.20%	4.96%	2.29%	AG: 0.64%
Temperate Japonica	767	20.90%	79.10%	0.00%	0.00%	NA
Tropical Japonica	504	92.30%	7.50%	0.00%	0.20%	NA
Japonica Intermediate	241	77.60%	22.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	0.00%	5.21%	0.00%	NA
Intermediate	90	70.00%	17.80%	6.67%	4.44%	AG: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431236819	A -> DEL	N	N	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> G	LOC_Os04g52540.1	upstream_gene_variant ; 2366.0bp to feature; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> G	LOC_Os04g52530.1	downstream_gene_variant ; 4851.0bp to feature; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> G	LOC_Os04g52530-LOC_Os04g52540	intergenic_region ; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> AG	LOC_Os04g52540.1	upstream_gene_variant ; 2365.0bp to feature; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> AG	LOC_Os04g52530.1	downstream_gene_variant ; 4852.0bp to feature; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0431236819	A -> AG	LOC_Os04g52530-LOC_Os04g52540	intergenic_region ; MODIFIER	silent_mutation	Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431236819	NA	3.98E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431236819	NA	5.66E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431236819	NA	8.83E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.48E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.13E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	6.13E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.69E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	8.48E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	1.74E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	3.45E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	3.13E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.85E-07	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	7.19E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	7.67E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	1.90E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	8.35E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	6.69E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	7.58E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	4.78E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	4.31E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.30E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	3.71E-06	5.48E-09	mr1705_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.63E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	2.04E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819	NA	6.21E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251