\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431236819:

Variant ID: vg0431236819 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 31236819
Reference Allele: AAlternative Allele: G,AG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTTGCATCGTAACTCTGTAAGAAAATTTTGATGAAAAATCAATATTTATTAGTACTAATTACAAAAAAGAACAAGTATTATAAAAATGATAGATTA[A/G,AG]
ATATGTTTGAAATATTGTGAAAATAATACGAGAGGTGATGATTGGATATGCTTACACGTTGATTTGTACATTTTAATAAATTATAGATTATGTTGTATAA

Reverse complement sequence

TTATACAACATAATCTATAATTTATTAAAATGTACAAATCAACGTGTAAGCATATCCAATCATCACCTCTCGTATTATTTTCACAATATTTCAAACATAT[T/C,CT]
TAATCTATCATTTTTATAATACTTGTTCTTTTTTGTAATTAGTACTAATAAATATTGATTTTTCATCAAAATTTTCTTACAGAGTTACGATGCAAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 17.10% 3.68% 2.45% AG: 0.49%
All Indica  2759 86.00% 3.30% 5.91% 3.99% AG: 0.80%
All Japonica  1512 53.70% 46.20% 0.00% 0.07% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 94.80% 4.40% 0.67% 0.17% NA
Indica II  465 84.30% 3.70% 5.38% 6.02% AG: 0.65%
Indica III  913 81.20% 0.00% 10.41% 6.90% AG: 1.53%
Indica Intermediate  786 85.90% 6.20% 4.96% 2.29% AG: 0.64%
Temperate Japonica  767 20.90% 79.10% 0.00% 0.00% NA
Tropical Japonica  504 92.30% 7.50% 0.00% 0.20% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 70.00% 17.80% 6.67% 4.44% AG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431236819 A -> DEL N N silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> G LOC_Os04g52540.1 upstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> G LOC_Os04g52530.1 downstream_gene_variant ; 4851.0bp to feature; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> G LOC_Os04g52530-LOC_Os04g52540 intergenic_region ; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> AG LOC_Os04g52540.1 upstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> AG LOC_Os04g52530.1 downstream_gene_variant ; 4852.0bp to feature; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0431236819 A -> AG LOC_Os04g52530-LOC_Os04g52540 intergenic_region ; MODIFIER silent_mutation Average:60.413; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431236819 NA 3.98E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431236819 NA 5.66E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431236819 NA 8.83E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.48E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.13E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 6.13E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.69E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 8.48E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 1.74E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 3.45E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 3.13E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.85E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 7.19E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 7.67E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 1.90E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 8.35E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 6.69E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 7.58E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 4.78E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 4.31E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.30E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 3.71E-06 5.48E-09 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.63E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 2.04E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431236819 NA 6.21E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251